Abstract
The following text replaces the corresponding text in the Materials and Methods section, which incorrectly described UAS>painlessFL constructs: The full length painless cDNA from BDGP gold collection (RE03641) has been used as a template. In this cDNA, a TN10 transposon was found to be inserted following nucleotide 1795. To remove the TN10 transposon, we have used a two step PCR strategy. Painless sequences flanking the TN10 sequence were amplified using primers couples (forward/reverse): caaggagacgcagcgcgtcttagccg/ggtaccaacatttgaaattaaatatttactc and gcggccgcggtcgttgtctggatattaa /cggctaagacgcgctgcgtctccttg. Next, the products of these two PCR were mixed to use as a new template and amplified using the following primers couple (forward/reverse): ttaatagcggccgcggtcgttgtctggatattaa/ttaataggtaccaacatttgaaattaaatatttactc. NotI and KpnI restriction sites were respectively included in those forward and reverse primers. The PCR product was verified by sequencing and revealed a single silent mutation at nucleotide 1605 changing C in T. It was subsequently cloned into a KpnI/NotI-cut pUAST-attb transformation vector [46]. This pUAST-attb-pain is available on request.
Highlights
The conversion of physical forces into biochemical information is fundamental to development and physiology
Cardiac muscle continuously adapts to the mechanical constraints generated by its own rhythmic contractile activity
We show that the heart responds to mechanical constraints by diastolic heart arrests, and we demonstrate that this phenotype can be used to identify genes controlling this particular mechanotransduction pathway
Summary
The conversion of physical forces into biochemical information is fundamental to development and physiology. Defects in mechanotransduction, often caused by mutation or misregulation of proteins that disturb cellular or extracellular mechanics, are implicated in the development of various diseases, ranging from muscular dystrophies and cardiomyopathies to cancer progression and metastasis [2]. In addition to these long term effects on development which participate in the transcriptional control of organogenesis, mechanical stimuli can induce acute responses. Cardiac myocytes are subjected and respond to a variety of mechanical forces, including intrinsic stretch responses which occur continuously during contraction/relaxation cycles, and extrinsic forces, induced by blood flow and by the local mechanical environment [8]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
