Abstract
Arginase (EC 3.5.3.1) catalyzes the last step of urea synthesis in the liver of ureotelic animals. The nucleotide sequence of rat liver arginase cDNA, which was isolated previously (Kawamoto, S., Amaya, Y., Oda, T., Kuzumi, T., Saheki, T., Kimura, S., and Mori, M. (1986) Biochem. Biophys. Res. Commun. 136, 955-961) was determined. An open reading frame was identified and was found to encode a polypeptide of 323 amino acid residues with a predicted molecular weight of 34,925. The cDNA included 26 base pairs of 5'-untranslated sequence and 403 base pairs of 3'-untranslated sequence, including 12 base pairs of poly(A) tract. The NH2-terminal amino acid sequence, and the sequences of two internal peptide fragments, determined by amino acid sequencing, were identical to the sequences predicted from the cDNA. Comparison of the deduced amino acid sequence of the rat liver arginase with that of the yeast enzyme revealed a 40% homology.
Highlights
Susumu KawarnotoztllY, oshihiro Amayaz, Kaoru Murakamiz, Fuminori Tokunaga,ll Sadaaki Iwanagall,Keiko Kobayashi**,Takeyori Saheki**, SadaoKimuraB, and Masataka Moriz
We isolated cDNA clones for rat liver arginase [8].Dizikes et al [9] isolated a rat liver arginase cDNA, the lengthof which is less than half t h a t of our clone
The amino acid composition of rat liver arginase is in close agreement with that predicted from the ACTCTTGGCAACACACCAGAGGAGGTGACTCGTACTCTCAACACCCCACTCCCGTTCACC nucleotide sequence (Table I)
Summary
RatLiverArginase cDNA-Fig. 1 (see Miniprint) showsa partial restriction map and the sequence analysis strategy of theplasmidpARGr-2 encoding rat liver arginase [8]. The cDNA clone pARGr-2 contained 1398 nucleotides,including 12 bases of poly(A). The translation initiation sitweas assigned to the methionine codon ATG at nucleotide positions 1-3. The possibility that the methionine codon ATG at nucleotide positions -6-. The nucleotidesequence of rat liver arginase cDNA at the NH’-terminal portion has a high homology with that of human liver arginase cDNA, which was cloned and sequenced,’. The predicted NH2-terminal aminoacid sequence of human liver arginase is highly homologous to that of the rat Portions of this paper As the size of the mRNA for rat CCATTCTCCTCGCTCACCCCCTGCATATCTGCCAACGACATCCTCTACATCCCCTTCCCA liver arginase was estimated by Northern analysis tobe 1600. ClyPhaSerTrpV ~ LThrProCysIl ~ S ~ r A ~ ~ L ~ ~ A ~ p I ~ ~ V ~ ~ T ~ br alsle~s G(l8y),Lth~ eu AcrD~NA insert of 1398 base pairs is expected to 550570 cover about 90% of the complete mRNA
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
