Abstract

China has a long history of sheep (Ovis aries [O. aries]) breeding and an abundance of sheep genetic resources. Knowledge of the complete O. aries mitogenome should facilitate the study of the evolutionary history of the species. Therefore, the complete mitogenome of O. aries was sequenced and annotated. In order to characterize the mitogenomes of 3 Chinese sheep breeds (Altay sheep [AL], Shandong large-tailed sheep [SD], and small-tailed Hulun Buir sheep [sHL]), 19 sets of primers were employed to amplify contiguous, overlapping segments of the complete mitochondrial DNA (mtDNA) sequence of each breed. The sizes of the complete mitochondrial genomes of the sHL, AL, and SD breeds were 16,617 bp, 16,613 bp, and 16,613 bp, respectively. The mitochondrial genomes were deposited in the GenBank database with accession numbers KP702285 (AL sheep), KP981378 (SD sheep), and KP981380 (sHL sheep) respectively. The organization of the 3 analyzed sheep mitochondrial genomes was similar, with each consisting of 22 tRNA genes, 2 rRNA genes (12S rRNA and 16S rRNA), 13 protein-coding genes, and 1 control region (D-loop). The NADH dehydrogenase subunit 6 (ND6) and 8 tRNA genes were encoded on the light strand, whereas the rest of the mitochondrial genes were encoded on the heavy strand. The nucleotide skewness of the coding strands of the 3 analyzed mitogenomes was biased toward A and T. We constructed a phylogenetic tree using the complete mitogenomes of each type of sheep to allow us to understand the genetic relationships between Chinese breeds of O. aries and those developed and utilized in other countries. Our findings provide important information regarding the O. aries mitogenome and the evolutionary history of O. aries inside and outside China. In addition, our results provide a foundation for further exploration of the taxonomic status of O. aries.

Highlights

  • The origins of domestic sheep (Ovis aries [O. aries]) breeds remain a controversial topic

  • We evaluated 3 O. aries breeds indigenous Region, Shandong large-tailed sheep (SD) from Liaocheng to China, the Altay sheep, Shandong large-tailed sheep, and City in Shandong Province, and small-tailed Hulun Buir small-tailed Hulun Buir sheep, which were of the fat-rump sheep from the Autonomous County of Evenki in the tailed, fat-tailed, and small-tailed varieties, respectively

  • The overlaps were 1 to 40 bp in size, The 22 transfer RNAs (tRNAs) encoded in the complete mitochondrial whereas the intergenic spacers were 1 to 32 bp in size genome of the sHL, AL, and SD breeds formed a typical (Table 4)

Read more

Summary

INTRODUCTION

The origins of domestic sheep (Ovis aries [O. aries]) breeds remain a controversial topic. China has a centuries-old tradition of sheep domestication, production, and breeding (Ma et al, 2006). Evaluation of the structure and function of mitochondrial DNA (mtDNA) provides information useful in the study of molecular evolution, classification, population genetic analysis, and relationship identification. Analyses of mtDNA have been used to illuminate the performed a molecular phylogenetic analysis using the maternal origins of populations (Bruford et al, 2003). Complete mitogenome and mtDNA control region via Animal mtDNA is a small extrachromosomal genome that unweighted pair group method with arithmetic means is typically 15 to 20 kb in size. This study will animal mitochondrial genomes contain the same 37 genes: facilitate further investigations of the phylogenetic. 2 ribosomal RNAs (rRNAs), 13 protein-coding genes and relationships of O. aries and provides important annotation. Constructed phylogenetic trees using the control region sequence (which includes the D-loop) and mitochondrial

MATERIALS AND METHODS
19 CTATGGCCGTCTGAGGCCTG
Tashkurgan sheep
27 Minxian Black Fur sheep
DISCUSSION
CONCLUSION
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call