Complete Genome Sequence Resource for Xanthomonas translucens pv. undulosa MAI5034, a Wheat Pathogen from Uruguay.

Abstract

HomePhytopathology®Vol. 112, No. 9Complete Genome Sequence Resource for Xanthomonas translucens pv. undulosa MAI5034, a Wheat Pathogen from Uruguay Previous Resource Announcement OPENOpen Access licenseComplete Genome Sequence Resource for Xanthomonas translucens pv. undulosa MAI5034, a Wheat Pathogen from UruguayFelipe Clavijo, Claudia Barrera, Aleksander Benčič, Valentina Croce, Jonathan M. Jacobs, Adriana J. Bernal, Ralf Koebnik, and Veronica Roman-ReynaFelipe ClavijoLaboratorio de Microbiología Molecular, Departamento de Biociencias, Facultad de Química, Universidad de la República, Montevideo, UruguaySearch for more papers by this author, Claudia BarreraDepartment of Biological Sciences, Universidad de Los Andes, Bogotá, ColombiaSearch for more papers by this author, Aleksander BenčičNational Institute of Biology, Ljubljana, SloveniaJožef Stefan International Postgraduate School, Ljubljana, SloveniaSearch for more papers by this author, Valentina CroceLaboratorio de Microbiología Molecular, Departamento de Biociencias, Facultad de Química, Universidad de la República, Montevideo, UruguaySearch for more papers by this author, Jonathan M. Jacobshttps://orcid.org/0000-0002-1553-2013Department of Plant Pathology, The Ohio State University, Columbus, OH, U.S.A.Infectious Diseases Institute, The Ohio State University, Columbus, OH, U.S.A.Search for more papers by this author, Adriana J. BernalDepartment of Biological Sciences, Universidad de Los Andes, Bogotá, ColombiaSearch for more papers by this author, Ralf Koebnik†Corresponding author: R. Koebnik; E-mail Address: [email protected]https://orcid.org/0000-0002-4419-0542Plant Health Institute of Montpellier, University of Montpellier, CIRAD, INRAE, Institut Agro, IRD, Montpellier, FranceSearch for more papers by this author, and Veronica Roman-Reynahttps://orcid.org/0000-0003-0072-8096Department of Plant Pathology, The Ohio State University, Columbus, OH, U.S.A.Infectious Diseases Institute, The Ohio State University, Columbus, OH, U.S.A.Search for more papers by this authorAffiliationsAuthors and Affiliations Felipe Clavijo1 Claudia Barrera2 Aleksander Benčič3 4 Valentina Croce1 Jonathan M. Jacobs5 6 Adriana J. Bernal2 Ralf Koebnik7 † Veronica Roman-Reyna5 6 1Laboratorio de Microbiología Molecular, Departamento de Biociencias, Facultad de Química, Universidad de la República, Montevideo, Uruguay 2Department of Biological Sciences, Universidad de Los Andes, Bogotá, Colombia 3National Institute of Biology, Ljubljana, Slovenia 4Jožef Stefan International Postgraduate School, Ljubljana, Slovenia 5Department of Plant Pathology, The Ohio State University, Columbus, OH, U.S.A. 6Infectious Diseases Institute, The Ohio State University, Columbus, OH, U.S.A. 7Plant Health Institute of Montpellier, University of Montpellier, CIRAD, INRAE, Institut Agro, IRD, Montpellier, France Published Online:13 May 2022https://doi.org/10.1094/PHYTO-01-22-0025-AAboutSectionsView articlePDFSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articleGenome AnnouncementThe bacterial species Xanthomonas translucens is responsible for bacterial leaf streak and black chaff of small grains and bacterial wilt of forage grasses (Egli et al. 1975; Jones et al. 1917; Sapkota et al. 2020; Vauterin et al. 1995). In particular, bacterial leaf streak of wheat represents the most limiting bacterial disease in wheat production worldwide (Duveiller et al. 1997). The X. translucens pathovar most commonly associated with wheat is pathovar undulosa (Smith et al. 1919).Until recently, genome sequences of 61 strains were available for this species at NCBI GenBank, 16 of which are complete genomes. Only one X. translucens genome sequence from a South American strain, UPB787, is currently available, which was isolated from barley in Paraguay in 1990. To enlarge the geographic coverage of the pathogen’s genomic resources, we present the first complete genome sequence of a South American strain of X. translucens, which reveals a surprising conservation of its repertoire of transcription activator-like effectors (TALEs) across continents.Strain MAI5034 was isolated in October 2018 from symptomatic wheat leaf tissue obtained in Soriano, Uruguay (Clavijo et al. 2022). Pathogenicity on wheat was confirmed in greenhouse assays. The strain was identified as X. translucens pv. undulosa by multilocus sequence analysis of the concatenated partial sequences of four housekeeping genes (dnaK, fyuA, gyrB, and rpoD) and, through multilocus sequence typing, it was assigned to novel sequence type ST3 (Clavijo et al. 2022).Strain MAI5034 was grown at 28°C on peptone-sucrose-agar medium (0.5% peptone, 2% sucrose, and 1.5% agar) for 24 h. Bacteria were then resuspended in 10 mM MgCl2 and diluted to an optical density at 600 nm of 1.0. Cells from 2 ml were harvested by centrifugation and washed once with 10 mM MgCl2, and genomic DNA was isolated using Qiagen Genomic tip 100/G (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.For library construction and DNA sequencing, performed by ohmX.bio (Gent, Belgium), 1 μg of DNA was mechanically fragmented with g-Tubes (Covaris) at approximately 13 kb. A sequencing library was prepared with the Ligation Sequencing kit (SQK-LSK110; Oxford Nanopore Technologies [ONT]) and the Native Barcode Expansion (PCR-free) (EXP-NBD114; ONT) based on the manufacturer’s protocol. For multiplexing with other samples, a unique barcode (barcode ID NB19, GTTCCTCGTGCAGTGTCAAGAGAT) was ligated to the sample type using the ONT direct-DNA (SQK-LSK109) library preparation kit in combination with the Native barcoding expansion (EXP-NBD104). Upon pooling of eight libraries, samples were sequenced on a GridION, R9.4 flow cell, and sequence reads were demultiplexed by ohmX.bio and provided as FASTQ files.Sequence reads were trimmed with Porechop (v0.2.4) and assembled using three different algorithms: Flye (version 2.8.1-b1676), Shasta, and Miniasm (Kolmogorov et al. 2020; Li 2016; Shafin et al. 2020; Wick 2017). In addition, the Flye and Miniasm assemblies were polished using Racon (Vaser et al. 2017). A comparison of these assemblies revealed the superior performance of the Racon-polished Flye assembly, as indicated by its better contiguity, completeness, and quality (Supplementary Table S1). However, manual inspection revealed significant issues with homopolymeric nucleotide runs, resulting in four frame shifts per TALE gene. Therefore, we applied Homopolish (version 0.0.1) on the Racon-polished Flye assembly (Huang et al. 2021), which resolved all of the problems at the TALE genes and reduced the number of predicted pseudogenes from 315 to 202 (see below).This procedure yielded one circular chromosome of 4,625,916 bp with a typical G+C content of 64.7%, corresponding to 139× sequencing coverage. The chromosome was annotated with GeneMarkS-2+ (Lomsadze et al. 2018), as implemented in the NCBI Prokaryotic Genome Annotation Pipeline (https://www.ncbi.nlm.nih.gov/genome/annotation_prok/), which predicted a total of 4,001 genes, including 3,736 coding genes, 202 pseudogenes, 53 transfer RNA genes, 4 noncoding RNAs, and 2 rRNA operons (5S, 16S, and 23S).Type 3 effectors and, in particular, TALEs, are of specific interest when trying to understand the pathogenicity of xanthomonads and their host adaptation (Boch and Bonas 2010; Jacques et al. 2016; White et al. 2009). For this reason, TALEs were predicted and classified using the AnnoTale suite (Grau et al. 2016). In total, seven TALE genes were found, belonging to the classes TalCT, TalCZ, TalDA, TalDC, TalDD, TalDE, and TalDF, all of which are widely conserved in strains of X. translucens pv. undulosa (Table 1; Fig. 1) (Falahi Charkhabi et al. 2017; Peng et al. 2016; Shah et al. 2021), arguing for a recent worldwide expansion of this pathovar (Khojasteh et al. 2019). Notably, a homolog of the tal8 gene in strain Xtu4699, which elevates expression of a 9-cis-epoxycarotenoid dioxygenase gene (TaNCED-5BS) in wheat, that encodes the rate-limiting step in the biosynthesis of the phytohormone abscisic acid for disease susceptibility (Peng et al. 2019), is present in strain MAI5034 (talDC). Two additional genes that contribute to virulence of strain ICMP 11055 are less conserved (Falahi Charkhabi et al. 2017). Whereas tal4b (talHM) is absent in strain MAI5034 and other strains of X. translucens pv. undulosa (Peng et al. 2016; Shah et al. 2021), strain MAI5034 encodes a novel allele of tal2, talDD.Table 1. Repeat-variable diresidue (RVD) sequences of completely sequenced Xanthomonas translucens pv. undulosa strainsaTALE classStrainsRVD patternTalCTICMP11055HN HD HD HD NI NI NI HN HD HD NH NN NI NN HDLW16, XtFa1NN HD HD HD NI NI NI HN HD HD NN NN NI NN HDMAI5034, P3, XtKm12, XtKm15, XtLr8, Xtu4699HN HD HD HD NI NI NI HN HD HD NN NN NI NN HDTalCZICMP11055, LW16, MAI5034, P3, XtFa1, XtKm12, Xtu4699NH NN HD NN HD NH HD YK NG NH Y* HD NN NI NG QDTalDAICMP11055, MAI5034, P3, XtFa1, XtKm12, XtKm15, XtLr8, Xtu4699HD YD NI NG NG NN YK NG HD NG NG ND NG QD NH HDLW16HD YD NI NG NG NN YK NG HD NG NG ND NG QD NH QDTalDBLW16NN HD KG HD HD HN NF NI NN HD HD HD HN HN HDP3NN HD NG HD HD HN NF NI NN NN HD HD HN HN HDXtKm15,b XtLr8NN HD NG HD HD HN NF NI NF HD HD HD HN HN HDXtu4699NN HD NG HD HD HN NF NI NH HD HD HD HN HN HDTalDCMAI5034, P3, XtFa1, XtLr8, Xtu4699NN NG HD HD HD KG NN Y* NG HD HD QD HNTalDDICMP11055NN HD NG NN HN KG NI HD NI HN HD HN HD Y* NG HD HD HNLW16NN HD NG NN HN KG NI HD NI HN HD HN HD HD NI HN HN HDMAI5034NN HD NG NN HN KG NI HD NI HN HD HN HD HD NI HN HD QDP3, XtFa1, XtKm12, XtKm15, XtLr8, Xtu4699NN HD NG NN HN KG NI HD NI NN HD HN HD HD NI HN HD QDLW16, XtKm12NN HD NG NN HN NG NI HD NI NN HD HD NN NN NI HN HDTalDELW16, MAI5034NN HD NG NN HN HN NN NI NI NH NN HD NN NH HD HDP3, XtFa1, XtKm15,b Xtu4699NN HD NG NN HN HN NI NI NI NH NN HD NN NH HD HDXtKm12NN HD NG NN HN HN NI NI NI NH NN HD HN NH HD HDTalDFICMP11055, LW16, MAI5034, P3, XtKm12, XtKm15, XtLr8, Xtu4699HD HN HN HD NH NH HG HD KG NN Y* NG HD HD HNXtFa1HD HN HN HD NH NH HG HD KG NN Y* NG HD NI NH NG HD HNTalHMICMP11055NN HD NG HD HD HG HD KG NN Y* NG NG HD HD QD HNXtKm15bNN HD NG HD HD HG HD KGTalHNICMP11055NN HD NG HD NG HD HD HG HD KG NN KG HD HN QD HNTalJDXtLr8NN HD NG NN Y* NG HD HD NN NH HD HDaAlignment of RVDs of transcription activator-like effectors (TALEs) of X. translucens pv. undulosa strains. RVDs that differ between otherwise highly conserved TALEs are underlined. An asterisk (*) indicates that the second amino acid of the RVD is missing.bThree TALE genes of strain XtKm15(talDB, talDE, and talHM) are recorded as pseudogenes due to in-frame stop codons or frameshift mutations (http://www.jstacs.de/downloads/List_of_classes.txt) (Grau et al. 2016).Table 1. Repeat-variable diresidue (RVD) sequences of completely sequenced Xanthomonas translucens pv. undulosa strainsaView as image HTML Fig. 1. Phylogenetic tree of Xanthomonas translucens pv. undulosa strains and repertoire of transcription activator-like (TAL) effector genes. Genome sequences were retrieved from GenBank (Sayers et al. 2022): ICMP 11055 (CP009750), XtKm15 (CP063997, CP063998, CP063999), XtLr8 (CP063993, CP063994, CP063995), Xtu4699 (CP008714), MAI5034 (CP089584), XtFa1 (CP063996), XtKm12 (CP064000), LW16 (CP043540), and P3 (CP043500). Calculation of genome-wide pairwise average nucleotide identities and phylogenetic analysis were performed on the enve-omics platform (http://enve-omics.ce.gatech.edu) (Rodriguez-R and Konstantinidis 2016). The unweighted pair-group method with arithmetic mean was used to build the phylogenetic tree (Sokal and Michener 1958). The interactive Tree Of Life suite was used for better visualization of the tree (https://itol.embl.de; Letunic and Bork 2019). Open rectangles symbolize the chromosomes of the X. translucens strains. For better comparability, genome sequences were rotated so that they start with the translation initiation codon of the dnaA gene. Position and orientation of TAL effector genes, as classified by the AnnoTale suite (Grau et al. 2016), are indicated by colored arrows. TAL effector genes are not drawn to scale. Genes encoding TalCZ in strains XtKm15 and XtLr8 are interrupted by the insertion of an IS element.Download as PowerPointThe lower diversity of TALE repertoires in the pathovar undulosa as compared with the pathovar translucens is also mirrored by their lower genetic diversity, which was observed in a cohort of 178 strains of small-grain-infecting xanthomonads (Khojasteh et al. 2019) and may support the hypothesis that the pathovar undulosa emerged or originated from the pathovar translucens. Such a scenario is also supported by the observation that the cbsA gene, a genetic switch between vascular and nonvascular plant pathogenesis (Gluck-Thaler et al. 2020), is disrupted by an IS1595-family transposase in strain MAI5034 and other strains of X. translucens pv. undulosa, ultimately resulting in nonsystemic infection.Data AvailabilityRaw reads and the complete genome were uploaded to the NCBI Sequence Read Archive and GenBank under BioProject accession PRJNA786744.AcknowledgmentsWe thank J. Grau, Martin-Luther-Universität Halle-Wittenberg, Germany, for assistance with the AnnoTale suite.The author(s) declare no conflict of interest.Literature CitedBoch, J., and Bonas, U. 2010. Xanthomonas AvrBs3 family-type III effectors: Discovery and function. Annu. Rev. Phytopathol. 48:419-436. https://doi.org/10.1146/annurev-phyto-080508-081936 Crossref, Medline, ISI, Google ScholarClavijo, F., Curland, R. D., Croce, V., Lapaz, M. I., Dill-Macky, R., Pereyra, S., and Siri, M. I. I. 2022. Genetic and phenotypic characterization of Xanthomonas species pathogenic of wheat in Uruguay. Phytopathology 112:511-520. https://doi.org/10.1094/PHYTO-06-21-0231-R Link, Google ScholarDuveiller, E., Bragard, C., and Maraite, H. 1997. Bacterial leaf streak and black chaff caused by Xanthomonas translucens. Pages 25-32 in: The Bacterial Disease of Wheat: Concept and Methods of Disease Management. E. Duveiller, L. Fucikovskil, and K. Rudolph, eds. CIMMYT, D.F, Mexico. Google ScholarEgli, T., Goto, M., and Schmidt, D. 1975. Bacterial wilt, a new forage grass disease. J. Phytopathol. 82:111-121. https://doi.org/10.1111/j.1439-0434.1975.tb02825.x Crossref, Google ScholarFalahi Charkhabi, N., Booher, N. J., Peng, Z., Wang, L., Rahimian, H., Shams-Bakhsh, M., Liu, Z., Liu, S., White, F. F., and Bogdanove, A. J. 2017. Complete genome sequencing and targeted mutagenesis reveal virulence contributions of Tal2 and Tal4b of Xanthomonas translucens pv. undulosa ICMP11055 in bacterial leaf streak of wheat. Front. Microbiol. 8:1488. https://doi.org/10.3389/fmicb.2017.01488 Crossref, Medline, ISI, Google ScholarGluck-Thaler, E., Cerutti, A., Perez-Quintero, A. L., Butchacas, J., Roman-Reyna, V., Madhavan, V. N., Shantharaj, D., Merfa, M. V., Pesce, C., Jauneau, A., Vancheva, T., Lang, J. M., Allen, C., Verdier, V., Gagnevin, L., Szurek, B., Beckham, G. T., De La Fuente, L., Patel, H. K., Sonti, R. V., Bragard, C., Leach, J. E., Noël, L. D., Slot, J. C., Koebnik, R., and Jacobs, J. M. 2020. Repeated gain and loss of a single gene modulates the evolution of vascular plant pathogen lifestyles. Sci. Adv. 6:eabc4516. https://doi.org/10.1126/sciadv.abc4516 Crossref, Medline, ISI, Google ScholarGrau, J., Reschke, M., Erkes, A., Streubel, J., Morgan, R. D., Wilson, G. G., Koebnik, R., and Boch, J. 2016. AnnoTALE: Bioinformatics tools for identification, annotation, and nomenclature of TALEs from Xanthomonas genomic sequences. Sci. Rep. 6:21077. https://doi.org/10.1038/srep21077 Crossref, Medline, ISI, Google ScholarHuang, Y. T., Liu, P. Y., and Shih, P. W. 2021. Homopolish: A method for the removal of systematic errors in nanopore sequencing by homologous polishing. Genome Biol. 22:95. https://doi.org/10.1186/s13059-021-02282-6 Crossref, Medline, ISI, Google ScholarJacques, M. A., Arlat, M., Boulanger, A., Boureau, T., Carrère, S., Cesbron, S., Chen, N. W., Cociancich, S., Darrasse, A., Denancé, N., Fischer-Le Saux, M., Gagnevin, L., Koebnik, R., Lauber, E., Noël, L. D., Pieretti, I., Portier, P., Pruvost, O., Rieux, A., Robène, I., Royer, M., Szurek, B., Verdier, V., and Vernière, C. 2016. Using ecology, physiology, and genomics to understand host specificity in Xanthomonas. Annu. Rev. Phytopathol. 54:163-187. https://doi.org/10.1146/annurev-phyto-080615-100147 Crossref, Medline, ISI, Google ScholarJones, L. R., Johnson, A. G., and Reddy, C. S. 1917. Bacterial blight of barley. J. Agric. Res. 11:625-643. Google ScholarKhojasteh, M., Taghavi, S. M., Khodaygan, P., Hamzehzarghani, H., Chen, G., Bragard, C., Koebnik, R., and Osdaghi, E. 2019. Molecular typing reveals high genetic diversity of Xanthomonas translucens strains infecting small-grain cereals in Iran. Appl. Environ. Microbiol. 85:e01518-19. https://doi.org/10.1128/AEM.01518-19 Crossref, Medline, ISI, Google ScholarKolmogorov, M., Bickhart, D. M., Behsaz, B., Gurevich, A., Rayko, M., Shin, S. B., Kuhn, K., Yuan, J., Polevikov, E., Smith, T. P. L., and Pevzner, P. A. 2020. metaFlye: Scalable long-read metagenome assembly using repeat graphs. Nat. Methods 17:1103-1110. https://doi.org/10.1038/s41592-020-00971-x Crossref, Medline, ISI, Google ScholarLetunic, I., and Bork, P. 2019. Interactive Tree Of Life (iTOL) v4: Recent updates and new developments. Nucleic Acids Res. 47:W256-W259. https://doi.org/10.1093/nar/gkz239 Crossref, Medline, ISI, Google ScholarLi, H. 2016. Minimap and miniasm: Fast mapping and de novo assembly for noisy long sequences. Bioinformatics 32:2103-2110. https://doi.org/10.1093/bioinformatics/btw152 Crossref, Medline, ISI, Google ScholarLomsadze, A., Gemayel, K., Tang, S., and Borodovsky, M. 2018. Modeling leaderless transcription and atypical genes results in more accurate gene prediction in prokaryotes. Genome Res. 28:1079-1089. https://doi.org/10.1101/gr.230615.117 Crossref, Medline, ISI, Google ScholarPeng, Z., Hu, Y., Xie, J., Potnis, N., Akhunova, A., Jones, J., Liu, Z., White, F. F., and Liu, S. 2016. Long read and single molecule DNA sequencing simplifies genome assembly and TAL effector gene analysis of Xanthomonas translucens. BMC Genomics 17:21. https://doi.org/10.1186/s12864-015-2348-9 Crossref, Medline, ISI, Google ScholarPeng, Z., Hu, Y., Zhang, J., Huguet-Tapia, J. C., Block, A. K., Park, S., Sapkota, S., Liu, Z., Liu, S., and White, F. F. 2019. Xanthomonas translucens commandeers the host rate-limiting step in ABA biosynthesis for disease susceptibility. Proc. Natl. Acad. Sci. U.S.A. 116:20938-20946. https://doi.org/10.1073/pnas.1911660116 Crossref, Medline, ISI, Google ScholarRodriguez-R, L. M., and Konstantinidis, K. T. 2016. The enveomics collection: A toolbox for specialized analyses of microbial genomes and metagenomes. PeerJ Preprints 4:e1900v1. https://doi.org/10.7287/peerj.preprints.1900v1 Google ScholarSapkota, S., Mergoum, M., and Liu, Z. 2020. The translucens group of Xanthomonas translucens: Complicated and important pathogens causing bacterial leaf streak on cereals. Mol. Plant Pathol. 21:291-302. https://doi.org/10.1111/mpp.12909 Crossref, Medline, ISI, Google ScholarSayers, E. W., Cavanaugh, M., Clark, K., Pruitt, K. D., Schoch, C. L., Sherry, S. T., and Karsch-Mizrachi, I. 2022. GenBank. Nucleic Acids Res. 50:D161-D164. https://doi.org/10.1093/nar/gkab1135 Crossref, Medline, ISI, Google ScholarShafin, K., Pesout, T., Lorig-Roach, R., Haukness, M., Olsen, H. E., Bosworth, C., Armstrong, J., Tigyi, K., Maurer, N., Koren, S., Sedlazeck, F. J., Marschall, T., Mayes, S., Costa, V., Zook, J. M., Liu, K. J., Kilburn, D., Sorensen, M., Munson, K. M., Vollger, M. R., Monlong, J., Garrison, E., Eichler, E. E., Salama, S., Haussler, D., Green, R. E., Akeson, M., Phillippy, A., Miga, K. H., Carnevali, P., Jain, M., and Paten, B. 2020. Nanopore sequencing and the Shasta toolkit enable efficient de novo assembly of eleven human genomes. Nat. Biotechnol. 38:1044-1053. https://doi.org/10.1038/s41587-020-0503-6 Crossref, Medline, ISI, Google ScholarShah, S. M. A., Khojasteh, M., Wang, Q., Taghavi, S. M., Xu, Z., Khodaygan, P., Zou, L., Mohammadikhah, S., Chen, G., and Osdaghi, E. 2021. Genomics-enabled novel insight into the pathovar-specific population structure of the bacterial leaf streak pathogen Xanthomonas translucens in small grain cereals. Front. Microbiol. 12:674952. https://doi.org/10.3389/fmicb.2021.674952 Crossref, Medline, ISI, Google ScholarSmith, E. F., Jones, L. R., and Reddy, C. S. 1919. The black chaff of wheat. Science 50:48. https://doi.org/10.1126/science.50.1280.48.a Crossref, Medline, ISI, Google ScholarSokal, R. R., and Michener, C. D. 1958. A statistical method for evaluating systematic relationships. Univ. Kans. Sci. Bull. 38:1409-1438. Google ScholarVaser, R., Sović, I., Nagarajan, N., and Šikić, M. 2017. Fast and accurate de novo genome assembly from long uncorrected reads. Genome Res. 27:737-746. https://doi.org/10.1101/gr.214270.116 Crossref, Medline, ISI, Google ScholarVauterin, L., Hoste, B., Kersters, K., and Swings, J. 1995. Reclassification of Xanthomonas. Int. J. Syst. Bacteriol. 45:472-489. https://doi.org/10.1099/00207713-45-3-472 Crossref, Google ScholarWhite, F. F., Potnis, N., Jones, J. B., and Koebnik, R. 2009. The type III effectors of Xanthomonas. Mol. Plant Pathol. 10:749-766. https://doi.org/10.1111/j.1364-3703.2009.00590.x Crossref, Medline, ISI, Google ScholarWick, R. 2017. Porechop. Github. https://github.com/rrwick/Porechop Google ScholarR. Koebnik and V. Roman-Reyna contributed equally to this work.Funding: Support was provided by the Institut de Recherche pour le Développement, France, for the North-South-South Network on Xanthomonads within the International Scientific Coordination Network-South (GDRI-Sud NSSN-X); the European Cooperation in Science and Technology (COST) Programme for support of A. Benčič and R. Koebnik through the EuroXanth COST Action CA16107, which was key in initiating this collaborative genome project; the American Malting Barley Association funding to J. M. Jacobs; the Faculty of Sciences at Universidad de los Andes to A. J. Bernal; and the Slovenian Research Agency to A. Benčič.The author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 112, No. 9 September 2022SubscribeISSN:0031-949Xe-ISSN:1943-7684 DownloadCaptionA grape cluster (‘Merlot’) with natural infection of ripe rot, caused by Colletotrichum spp., in a commercial vineyard in Maryland. The cluster was covered with a pest exclusion paper bag from bloom to bunch closure, as part of field trials to expose phenological cluster stages to naturally occurring Colletotrichum inoculum and environmental conditions, with a goal of identifying phenological stages susceptible to ripe rot (Cosseboom and Hu). Photo credit: Scott Cosseboom Metrics Article History Issue Date: 25 Aug 2022Published: 13 May 2022Accepted: 28 Mar 2022 Pages: 2036-2039 Information© 2022 The American Phytopathological SocietyFundingInstitut de Recherche pour le DéveloppementGrant/Award Number: GDRI-Sud NSSN-XKeywordsevolutiongenetic diversityTAL effectorwheatXanthomonasThe author(s) declare no conflict of interest.PDF download