Abstract
Tacaribe virus (TCRV) is the prototype of the New World arenaviruses (also known as TCRV serocomplex viruses). While TCRV is not itself a human pathogen, many closely related members of this group cause hemorrhagic fever, and thus TCRV has long served as an important BSL2 system for research into diverse areas of arenavirus biology. Due to its widespread use, a coding-complete sequence for both the S and L segments of the bipartite genome has been publically available for almost 30 years. However, more recently, this sequence has been found to contain significant discrepancies compared to other samples of the same original strain (i.e., TRVL-11573). Further, it is incomplete with respect to the genome ends, which contain critical regulatory elements for RNA synthesis. In order to rectify these issues we now present the first complete genome sequence for this important prototype arenavirus. In addition to completing the S segment 5’ end, we identified an apparent error in the L segment 3’ end as well as substantial discrepancies in the S segment intergenic region likely to affect folding. Comparison of this sequence with existing partial sequences confirmed a 12-amino-acid deletion in GP, including putative glycosylation sites, and a 4-amino-acid exchange flanking the exonuclease domain of NP. Accounting for these corrections, the TRVL-11573 strain appears to be nearly identical to that isolated in Florida in 2012. The availability of this information provides a solid basis for future molecular and genetic work on this important prototype arenavirus.
Highlights
Arenaviruses are small RNA viruses with two ambisense genome segments
The arenaviruses that infect mammals are divided into the Old World arenaviruses, which are primarily found in Africa, and the New World arenaviruses, which are mostly found in South America
Tacaribe virus (TCRV) was originally isolated from dead bats collected in Trinidad as part of a rabies surveillance program at the Trinidad Regional Virus Laboratory (TRVL)
Summary
TCRV (strain TRVL-11573) [9] was obtained through the University of Geneva and was originally sourced from the Arbovirus Reference Laboratory of the CDC [17]. The resulting cDNA was used with iProof (Bio-Rad) to amplify specific overlapping regions of the genome, which were purified using a NucleoSpin Gel and PCR Clean-Up Kit (Macherey-Nagel). Genome ends were amplified from cDNA using ligationanchored PCR, as described previously [18,19,20]. For 3’ end amplification, a 3’-end-blocked linker (/5Phos/ GAAGAGAAGGTGGAAATGGCGTTTTGG/3Phos/) was ligated to the viral RNA using T4 RNA ligase (NEB) prior to reverse transcription with a gene-specific primer and subsequent PCR using a gene-specific primer and a primer complementary to the linker sequence. For 5’ end amplification, cDNA was synthesized using an internal gene-specific primer and cleaned up using a QIAquick PCR Purification Kit (QIAGEN) prior to linker ligation and PCR as described above. IGR folding predictions were performed using Mfold [21]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
