Abstract
BackgroundMegalencephalic Leukoencephalopathy with subcortical Cysts (MLC) is a rare type of leukodystrophy characterized by astrocyte and myelin vacuolization, epilepsy and early-onset macrocephaly. MLC is caused by mutations in MLC1 or GLIALCAM, coding for two membrane proteins with an unknown function that form a complex specifically expressed in astrocytes at cell-cell junctions. Recent studies in Mlc1−/− or Glialcam−/− mice and mlc1−/− zebrafish have shown that MLC1 regulates glial surface levels of GlialCAM in vivo and that GlialCAM is also required for MLC1 expression and localization at cell-cell junctions.MethodsWe have generated and analysed glialcama−/− zebrafish. We also generated zebrafish glialcama−/−mlc1−/− and mice double KO for both genes and performed magnetic resonance imaging, histological studies and biochemical analyses.Resultsglialcama−/− shows megalencephaly and increased fluid accumulation. In both zebrafish and mice, this phenotype is not aggravated by additional elimination of mlc1. Unlike mice, mlc1 protein expression and localization are unaltered in glialcama−/− zebrafish, possibly because there is an up-regulation of mlc1 mRNA. In line with these results, MLC1 overexpressed in Glialcam−/− mouse primary astrocytes is located at cell-cell junctions.ConclusionsThis work indicates that the two proteins involved in the pathogenesis of MLC, GlialCAM and MLC1, form a functional unit, and thus, that loss-of-function mutations in these genes cause leukodystrophy through a common pathway.
Highlights
Megalencephalic Leukoencephalopathy with subcortical Cysts (MLC) is a rare type of leukodystrophy characterized by astrocyte and myelin vacuolization, epilepsy and early-onset macrocephaly
One hundred pg of each TALE Nuclease messenger RNA (mRNA) were injected into one cell zebrafish embryos, DNA was isolated from pooled embryos at 3dpf and the target sequence amplified with the following primers: GCCCTGAGTGGACAAATCAT and AAACTGACAACAGCGCACAC to check if the BsrBI restriction site was lost due to the action of the TALE nucleases and the subsequent mistakes made by the cellular repair mechanisms
Experimental evidence suggests that glialcama and not glialcamb exerts similar functions to its orthologue GlialCAM: i) when expressed transiently in cell lines, glialcama is detected in cell junctions, while glialcamb is intracellular [29]; ii) glialcama is able to target MLC1 and ClC-2 to cell junctions in cell lines, but not glialcamb [29]; iii) glialcama modifies the functional properties of human and zebrafish ClC-2 proteins expressed in Xenopus oocytes, whereas glialcamb reduces ClC-2 function [32]; iv) it has been shown that in mlc1−/− glialcama is mislocalized [29], as happens with GlialCAM in Mlc1−/− mice [15] and v) mlc1 and glialcama could be co-immunoprecipitated (Additional file 1: Figure S1)
Summary
Megalencephalic Leukoencephalopathy with subcortical Cysts (MLC) is a rare type of leukodystrophy characterized by astrocyte and myelin vacuolization, epilepsy and early-onset macrocephaly. MLC is caused by mutations in MLC1 or GLIALCAM, coding for two membrane proteins with an unknown function that form a complex expressed in astrocytes at cell-cell junctions. Results: glialcama−/− shows megalencephaly and increased fluid accumulation In both zebrafish and mice, this phenotype is not aggravated by additional elimination of mlc. Mlc protein expression and localization are unaltered in glialcama−/− zebrafish, possibly because there is an up-regulation of mlc mRNA. In line with these results, MLC1 overexpressed in Glialcam−/− mouse primary astrocytes is located at cell-cell junctions. GlialCAM is an adhesion molecule of the immunoglobulin superfamily expressed predominantly in astrocytes and oligodendrocytes [15, 16]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
