Comparative population genetics of the German shepherd dog in South Africa

N J Coutts,E H Harley

doi:10.4102/sajs.v105i3/4.65

Abstract

Modern breeding practices strive to achieve distinctive phenotypic uniformity in breeds of dogs, but these strategies are associated with the inevitable loss of genetic diversity. Thus, in parallel with the morphological variation displayed by breeds, purebred dogs commonly express genetic defects as a result of the inbreeding associated with artificial selection and the reduction of selection against disease phenotypes. Microsatellite marker analyses of 15 polymorphic canine loci were used to investigate measures of genetic diversity and population differentiation within and between German-bred and South African-bred German shepherd dogs. These data were quantified by comparison with typically outbred mongrel or crossbred dogs. Both the imported and locally-bred German shepherd dogs exhibited similar levels of genetic diversity. The breed is characterised by only a moderate loss of genetic diversity relative to outbred dogs, despite originating from a single founding sire and experiencing extensive levels of inbreeding throughout the history of the breed. Non-significant population differentiation between the ancestral German and derived South African populations indicates sufficient contemporary gene flow between these populations, suggesting that migration resulting from the importation of breeding stock has mitigated the effects of random genetic drift and a population bottleneck caused by the original founder event in South Africa. Significant differentiation between the combined German shepherd dog population and the outbred dogs illustrates the effects of selection and genetic drift on the breed since its establishment just over 100 years ago.

Highlights

Mitochondrial DNA analyses have suggested that dogs and wolves diverged in multiple events over 100 000 years ago,[1,2] with a possible east Asian origin.[3]
We have investigated the impact that this founder event, and the subsequent population bottleneck with its associated inbreeding and genetic drift, has had on the genetic diversity exhibited by South African-bred German shepherd dogs
Measures of genetic diversity All outbred dog populations sampled from Cape Town, Port

Summary

Introduction

Mitochondrial (mt) DNA analyses have suggested that dogs and wolves diverged in multiple events over 100 000 years ago,[1,2] with a possible east Asian origin.[3]. German shepherd dogs were introduced to South Africa with the first dog registered with the Kennel Union of Southern Africa in 1913; the population remained relatively small, with just 43 dogs registered between 1916 and 1919 We have investigated the impact that this founder event, and the subsequent population bottleneck with its associated inbreeding and genetic drift, has had on the genetic diversity exhibited by South African-bred German shepherd dogs. Low levels of genetic diversity and minimal gene flow between isolated populations are considered to be significant factors contributing towards the many genetic diseases commonly expressed in purebred dogs and these data have been quantified by comparison with typically outbred mongrel or crossbred dogs that rarely express such traits.[12]

Materials and methods

F: TATCGACTTTATCACTGTGG R

Results

Discussion