Abstract
Beta1,3-galactosyltransferase beta3Gal-T5 is highly expressed in the colons of humans and certain primates due to a retroviral long terminal repeat (LTR) acting as a strong promoter. Because this promoter is inactive in other human tissues or mice, we attempted to understand how adoption of a retrotransposon allowed the gene to acquire tissue-specific expression. We identified three novel 5'-UTRs of beta3Gal-T5 mRNA, types A, B, and C, and found widespread expression of the type A transcript at much lower levels than the LTR transcript, the expression of which is restricted to organs of the gastrointestinal tract. Expression of the type C 5'-UTR transcript was mostly restricted to the ileum, where it was expressed at high levels. We cloned the 5'-flanking regions of both types A and B 5'-UTRs, found deletion constructs functionally active as promoters, and identified CCAAT-binding factor (CBF) and hepatocyte nuclear factor 1 (HNF-1) as the principal nuclear factors controlling the promoters of types A and B 5'-UTR transcripts, respectively. The CCAAT-binding factor binding site and the entire downstream sequence driving the expression of type A transcripts in humans are structurally and functionally conserved in mice, where they constitute a uniquebeta3Gal-T5 promoter that appears to be the ancestral promoter of the gene. The HNF-1 binding motif of the second human promoter is identical to the HNF-1/Cdx binding motif of the LTR promoter but is in the antisense orientation, resulting in much lower binding affinity and promoter strength. These data may explain the successful insertion of the transposon during evolution.
Highlights
Cells [1, 2]. 3Gal-T5 is highly expressed in human colon mucosa, down-regulated in colon cancers [3], and large amounts of its reaction products are found in the bile and small intestine [4, 5]
We studied the 5Ј-UTR of 3Gal-T5 transcripts through rapid amplification of cDNA ends (RACE) analysis of RNA isolated from different human sources and determined their relative expression in various tissues and cell lines using competitive reverse transcription (RT)-PCR
We focused on the 5Ј-flanking region of novel 5Ј-UTR transcripts, trying to identify sequences active as promoters, using the luciferase reporter assay and binding sites for transcription factors through electrophoretic mobility shift assay (EMSA)
Summary
Cell Lines, Tissues, and RNAs—Human breast cancer cell lines MCF-7 and MDA-MB-231 (a gift of Dr Fabio Dall’Olio, University of Bologna, Italy) and the pancreas carcinoma cell line Capan-2 (American Type Culture Collection HTB 80) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 100 units/ml penicillin, 1 mg/ml streptomycin, and 2 mM L-glutamine. Total and poly(A)ϩ RNAs were prepared from human tissues or cell lines as previously reported [3, 16]. Amplifications (35 cycles) were performed in 25 l of LA Taq (Takara) according to the manufacturer’s recommendations, with 4 l of the RTs as the template. The human and mouse -actin and human 3Gal-T5 coding sequence competitors and oligonucleotide primers used were those previously described [3]. The oligonucleotide NdeI/HindIII ends are underlined; shown are primer sequences for exons 1C (bold) and 1B (italic): 5Ј-TATGAAGGGCATTGGAGACCCAGGGACCGCCTGCCCATTACAGTGACTCACA (upper strand) and 5Ј-AGCTTGTGAGTCACGTAATGGGCATGGCGGTCCCTGGGTCTCCAATGCCCTTCA (lower strand). Mouse 3GalT5 cDNA was obtained by PCR and cloned in the pCDM8 vector using an upper strand primer that annealed to the mouse first exon (5Ј-CGTCCCCTGCCCTGTCCCTTCTC) and a lower strand primer that annealed to the end of the coding sequence (5Ј-GGTCCTAGGTGCCCCCAGGGTCC). The 25-l reaction contained 150 ng of human placenta genomic DNA as the template and primers
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
