Abstract

Recently, minipig has been considered as an animal model that is appropriate for human disease model to study toxicology, pharmacology, and xenotransplantation. Nevertheless, minipigs are bred in various environment according to their use. Here, we suggest that minipigs used for research should be bred in well-controlled facility, comparing immune status of pigs raised in different breeding environment. DNA microarray was performed with ear skin and placenta of Landrace domestic pigs (DPs) and Minnesota germ-free minipigs (GPs). Their immune transcriptome was analyzed by gene ontology (GO) annotation database, based on criteria of |log2 fold change| ≥1 with P ≤ 0.05. As a result, we found that immune related genes in the ear skin of DPs were highly activated, compared to GPs. On the other hand, no significant s were found in the placenta. Quantitative real-time PCR (qRT-PCR) was performed in five candidate immune genes. Their fold changes were consistent with the results from DNA microarray (P ≤ 0.05). In conclusion, we experimentally proved that porcine immune system was affected by different breeding environment, suggesting the importance of controlling microbes in animal room for the qualified research.

Highlights

  • Experimental animal models have been considered as important research tool to conduct preclinical study and identify human disease mechanism

  • Comparison of immune related genes in the ear skin and placenta of Domestic pig (DP) compared to Germ free minipig (GP) First, we found that the number of up-regulated genes in the ear skin (67/73) was about 7 times greater than that in the placenta (10/73), compared DPs with GPs

  • Validation of Differentially expressed gene (DEG) data by using quantitative real-time PCR qRT-PCR was performed with five candidate genes including Interleukin 18 receptor alpha (IL-18R1), Cluster of differentiation 40 ligand (CD40LG) for ear skin, Interleukin 1 beta (IL-1B) for placenta, Interleukin 6 (IL-6), and 2′-5′-Oligoadenylate synthetase 1 (OAS1) to validate DNA microarray result

Read more

Summary

Introduction

Experimental animal models have been considered as important research tool to conduct preclinical study and identify human disease mechanism. Arguments to utilize those animals for research have been constantly raised due to ethical issues and lacks of experiment reproducibility [3] To overcome these problems, the minipig has been raised as. Lee et al Laboratory Animal Research (2020) 36:44 facility such as Specific Pathogen Free or Germ-free grade [5]. Immunogen, such as bacteria, in the conventional facility could bring out infection and induce activation of immune response, which leads to affect experiment data. Transcriptome profiling and comparative analysis between domestic pigs (DPs) and germ-free minipigs (GPs) were performed using DNA microarray and quantitative real-time PCR (qRT-PCR). Pearson’s correlation coefficient was used to measure statistical relationship between qRT-PCR and DNA microarray

Results
F: GCTACACTGAGGACCAGGTTG
Discussion
Conclusions

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.