Abstract
The aim of the present study was to evaluate the protective effects of a combination of deep sea water (DSW) and Sesamum indicum leaf extract (SIE) against high-fat diet (HFD)-induced obesity and investigate its molecular mechanisms in adipose tissue. ICR mice were randomly divided into three groups: HFD control (HFC), DSW and DSW + 125 mg/kg SIE (DSS) groups. The mice in the HFC group had free access to drinking water while those in the DSW and DSS groups had free access to DSW. The mice in the DSS group were treated with SIE once per day for 8 weeks. The mice in all three groups were allowed to freely access a HFD. Compared with the HFC group, the DSS group showed lower body weight gain and serum levels of glucose, triglycerides and leptin. Histological analyses of the epididymal white, retroperitoneal white and scapular brown adipose tissue of mice in the DSS group revealed that the adipocytes were markedly decreased in size compared with those in the HFC group. Moreover, DSS significantly increased the levels of phosphorylated adenosine monophosphate-activated protein kinase (AMPK) and its substrate, acetyl-CoA carboxylase (ACC) in mice epididymal adipose tissues. Furthermore, DSS upregulated the expression levels of lipolysis-associated mRNA, specifically peroxisome proliferator-activated receptor-α (PPAR-α) and cluster of differentiation 36 (CD36), and energy expenditure-associated mRNA, namely uncoupling protein 2 (UCP2) and carnitine palmitoyltransferase-1 (CPT1) in the epididymal adipose tissues. By contrast, DSS suppressed the expression of the lipogenesis-related gene sterol regulatory element-binding protein-1 (SREBP1) at the mRNA level. These results suggest that DSS is effective for suppressing body weight gain and enhancing the lipid profile.
Highlights
Obesity is a metabolic syndrome caused by an imbalance between energy intake and expenditure
deep sea water (DSW) was obtained from Herb Valley Life Science (Seoul, Korea); rabbit anti-mouse polyclonal phospho‐adenosine monophosphate‐activated protein kinase (p‐AMPKα; cat. no., 2531L; dilution 1:2,000), rabbit antimouse polyclonal AMPKα, rabbit anti-mouse polyclonal phospho‐acetyl‐CoA carboxylase (p‐ACC; cat. no., 3661L; dilution 1:2,000) and rabbit anti-mouse polyclonal ACC antibodies were from Cell Signaling Technology (Beverly, MA, USA); goat anti-mouse polyclonal immunoglobulin G (IgG) actin antibody was from Santa Cruz Biotechnology (Dallas, TX, USA); and the high‐fat diet (HFD) was purchased from Research Diets Inc. (D12451; New Brunswick, NJ, USA)
The cDNA fragment was amplified by PCR using the following specific primers: Cluster of differentiation 36 (CD36) sense, 5'‐TCCTCTGACATTTGCAGGTCTATC‐3' and anti‐sense, 5'‐GTGAATCCAGTTATGGGTTCCAC‐3'; proliferator‐activated receptor‐α (PPAR‐α), sense 5'‐CCCTGAACATCGAGTGTCGA‐3' and anti‐sense 5'‐CTTGCCCAGAGATTTGAGGTCCT‐3'; uncoupling protein 2 (UCP2), sense 5'‐GCAAGCTCAATGTTGGTGTCTT‐3' and anti‐sense 5'‐ACTCTGCAGATAGACAGGCCTG‐3'; carnitine palmitoyltransferase‐1 (CPT1), sense 5'‐CCTGGGCATGATTGCAAAG‐3' and anti‐sense 5'‐ACAGACTCCAGGTACCTGCTCA‐3'; sterol regulatory
Summary
Obesity is a metabolic syndrome caused by an imbalance between energy intake and expenditure. It is associated with a number of health problems, including hyperlipidemia, hypertension, type 2 diabetes, coronary heart disease, cancer, respiratory complications and osteoarthritis [1,2]. A high‐fat diet (HFD) is one of the most important environmental factors associated with obesity. When a diet with a high‐fat content is consumed on a regular basis, some of the fat remains in the body and results in the accumulation of excessive body fat [6]. Visceral fat, which is formed around the major organs, stores energy in the form of triglycerides (TGs) and its accumulation has a pathophysiological role in the development of metabolic syndromes including obesity, hyperlipidemia and diabetes [7,8]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
