Abstract
Food allergies can greatly harm people’s health, and therefore detecting allergens in foods is extremely important. By integrating loop-mediated isothermal amplification (LAMP) with a microfluidic chip, we have developed a method for detecting the allergen genes of peanut (Arachis hypogaea), sesame (Sesamum indicum), and soybean (Glycine max) using a colorimetric method suitable for the naked eye, known as the colorimetric LAMP microfluidic chip. In the presence of peanut, sesame, or soybean in the samples, the corresponding reaction well of the microfluidic chip will appear pink, or otherwise remain light brown. This method of detection is specific and can easily distinguish these three allergens from others in foods. The detection limit for peanut, sesame and soybean allergens was 0.4 ng/μL using the LAMP-microfluidic chip. The accuracy of this novel and rapid method was validated using allergenic foods obtained commercially and was comparable with that of the typical TaqMan real-time PCR method.
Highlights
Food allergies can greatly harm people’s health, and detecting allergens in foods is extremely important
We aim to combine loop-mediated isothermal amplification (LAMP) with microfluidic chip technology[30], to develop a colorimetric LAMP microfluidic chip for simultaneously detecting peanut, sesame and soybean allergens in one chip[31]
We screened a total of 12 sets of LAMP primers for the different allergens, selecting one for each allergen: EF609643.1, EU493458.1, and AF240005.1 from the NCBI GenBank database for Ara h 6, allergen 2 S albumin, and Gly m Bd 28 K, respectively (Table 1) to provide the following results
Summary
Food allergies can greatly harm people’s health, and detecting allergens in foods is extremely important. Common methods for detecting allergenic protein components are enzyme-linked immunosorbent assay (ELISA)[7], matrix-assisted laser desorption ionization – time-of-flight/mass spectrometry (MALDI-TOF/MS)[8], and western blotting[9], while other techniques can detect the allergen gene, for example, polymerase chain reaction (PCR)[10], genetic maker[11,12,13], gene microarray chip[14] and pyrosequencing[15]. All these methods can be cumbersome to use and require expensive equipment. Primer sequence F3 ATCTTCATTGATCATATAGCACA B3 GGCTTAGTATGTGAGGTACG FIP ATGCAAATACTCCAAGATTCCCATT-TAATTACTACAGCAAAGCCTGA BIP GCATGAAAATGTAACGTGGAAGC-TAAAGGGAATGGAGGGTGG F3 GGAACGTGGACGAGAGGT B3 CGCTTGGTTGATTGCGATTC FIP GATTGGCCCTCCTGGTAGCC-GCTGTGAGGCCATTAGGC BIP ACAGCAGGTTTACCAGAGGGC-ATTGGCATTGCTGGGGTC F3 GGAAGCAAAGCTGGGATT B3 GAAATATGTGAACTTATGATGGATG FIP TGAACCAGATGGAATCATGTACAA-TGATGATGAACTAGCGGAA BIP TAGGAGAAGGTCAGAGACTTCACG-ATGCATGTACCTGGAAGG
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have