Abstract
Staphylococcus aureus (S.aureus) is the most common pathogen found in hospitals, community-acquired infections and colonizes up to 50% of humans, including mucous membranes and damaged skin. Some strains produce enterotoxins (Ent) as staphylococcal enterotoxin A (SEA) which is involved in 75% of food poisoning outbreaks. Few methods are sensitive and specific enough to confirm the diagnosis of staphylococcal food poisoning. In this study, a segment of Ent A-ORF with molecular weight 774 bp was amplified, cloned, sequenced and aligned with published Ent A-ORFs. Ent A-ORF was subcloned into bacterial expression vector (GST-PGEX4T1 vector) and expressed as a fusion protein with GST-tagged protein. A band size of 27 kDa of purified Ent A protein was cleaved from GST protein by thrombin. The expressed protein of Ent A was identified by strong reaction with commercialized polyclonal antibodies against Ent A. Antiserum against Egyptian recombinant Ent A protein was produced by immunization of Balb/c mice, the produced recombinant polyclonal antibodies had a titre of 1:2500 in direct ELISA. The produced recombinant polyclonal antibody was evaluated and reacted specifically in Western immunoblotting analysis and ELISA test. Finally from the obtained results, the produced recombinant protein of Ent A can be used successfully for production of recombinant polyclonal antibodies and used in large-scale detection of staphylococcal enterotoxin A.
Highlights
Staphylococcal enterotoxins (SEs) are the second most common causal agents of food poisoning and clinical infections throughout the world [1,2]
The bacterial DNAs were extracted from the positive control (S.aureus strain ATCC number 9128 was used as reference strain) and positive tested sample SA 41 and the two specific primers for Ent A gene as follows: Ent A-Forward (Ent A-F): 5’CGGGATCCATGAAAAAAACAGCATTTACA’3 Ent A–R: 5’CCGCTCGAGTTAACTTGTATATAAATATATAT’3
According to the manual instructions of GST Gene Fusion System Handbook (GE Healthcare life Science), the recombinant protein of Ent A was separated from GST protein by Thrombin enzyme
Summary
Staphylococcal enterotoxins (SEs) are the second most common causal agents of food poisoning and clinical infections throughout the world [1,2]. For developing of an effective immunodetection system, availability of sensitive and specific antibodies against SEs is the major bottleneck. About a dozen species are frequently carried on humans, including Staphylococcus aureus, S. epidermidis, S. haemolyticus, S. capitis, S. hominis, S. cohnii, S. lugdunensis, S. schleiferi, S. saprophyticus, S. simulans, S. warneri and S. xylosus. All these species are capable of causing disease in humans, but S. aureus is by far the most aggressive pathogen and is the species most commonly implicated in food poisoning [3]. This work focused on enterotoxin A from S. aureus
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
