Year-end Sale % OFF 
Abstract
We report sequence of Thermus thermophilus HB8 DNA containing the gene (cycA) for cytochrome c552 and a gene (cycB) encoding a protein homologous with one subunit of an ATP-binding cassette transporter. The cycA gene encodes a 17-residue N-terminal signal peptide with following amino acid sequence identical to that reported by (Titani, K., Ericsson, L. H., Hon-nami, K., and Miyazawa, T. (1985) Biochem. Biophys. Res. Commun. 128, 781-787). A modified cycA was placed under control of the T7 promoter and expressed in Escherichia coli. Protein identical to that predicted from the gene sequence was found in two heme C-containing fractions. Fraction rC552, characterized by an alpha-band at 552 nm, contains approximately 60-70% of a protein highly similar to native cytochrome c552 and approximately 30-40% of a protein that contains a modified heme. Cytochrome rC552 is monomeric and is an excellent substrate for cytochrome ba3. Cytochrome rC557 is characterized by an alpha-band at 557 nm, contains approximately 90% heme C and approximately 10% of non-C heme, exists primarily as a homodimer, and is essentially inactive as a substrate for cytochrome ba3. We suggest that rC557 is a "conformational isomer" of rC552 having non-native, axial ligands to the heme iron and an "incorrect" protein fold that is stabilized by homodimer formation.
Highlights
We report sequence of Thermus thermophilus HB8 DNA containing the gene for cytochrome c552 and a gene encoding a protein homologous with one subunit of an ATP-binding cassette transporter
We describe here the first heterologous expression system for large scale preparation of Thermus cytochrome c552 from E. coli and our initial characterization of the gene products
Refs. 49 and 50) to design a nondegenerate oligonucleotide probe for the gene that was complimentary to the protein sequence, QGQIEVKGMKYNG: 5Ј-(CCGTTCTACTTCATCCCCTTGACCTCGATCTGCCCCTG)
Summary
We report sequence of Thermus thermophilus HB8 DNA containing the gene (cycA) for cytochrome c552 and a gene (cycB) encoding a protein homologous with one subunit of an ATP-binding cassette transporter. In the course of constructing a deletion series of a Thermus genomic DNA fragment for sequencing the c552 locus, we observed that colonies from a certain time point in the series were distinctly reddishbrown in color [8]. This led us to attempt engineered expression of the cytochrome c552 gene in E. coli
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
