Abstract
Insulin receptor substrate-1 (IRS-1) protein is a major substrate of the insulin receptor tyrosine kinase and is essential for transducing many of the biological effects of insulin including mitogenesis, gene expression, and glucose transport. The N terminus of IRS-1 contains a pleckstrin homology (PH) domain that is critical for recognition and subsequent phosphorylation of IRS-1 by the activated insulin receptor. Here we report the isolation of a novel protein, PHIP (PH-interacting protein), which selectively binds to the PH domain of IRS-1 in vitro and stably associates with IRS-1 in vivo. Importantly, mutants of the IRS-1 PH domain that disrupt the PH fold fail to bind to PHIP. Anti-phosphotyrosine immunoblots of PHIP revealed no discernible insulin receptor-regulated phosphorylation, suggesting that PHIP is not itself a substrate of the insulin receptor. In contrast to full-length PHIP, overexpression of the PH-binding region of PHIP has a pronounced inhibitory effect on insulin-induced IRS-1 tyrosine phosphorylation levels. Furthermore, expression of this dominant-negative PHIP mutant leads to a marked attenuation of insulin-stimulated mitogen-activated protein kinase activity. We conclude that PHIP represents a novel protein ligand of the IRS-1 PH domain that may serve to link IRS-1 to the insulin receptor.
Highlights
Insulin receptor substrate-1 (IRS-1) protein is a major substrate of the insulin receptor tyrosine kinase and is essential for transducing many of the biological effects of insulin including mitogenesis, gene expression, and glucose transport
Isolation and Characterization of IRS-1 pleckstrin homology (PH)-binding Proteins—In an attempt to identify proteins that bind to the PH domain of IRS-1, we used a yeast two hybrid screen in which the PH domain from rat IRS-1 was used as a bait to screen a murine 10.5-day embryonic cDNA library
Sequence analysis of a cDNA clone, VP1.32, which displayed the strongest interaction with the IRS-1 PH domain, revealed an open reading frame of 204 amino acids with no significant homology to any known proteins
Summary
BTM116 Yeast Two Hybrid Constructs—PH domains from rat IRS-1 (residues 3–133) [13], mouse SOS1 (residues 448 –577) [14], human RasGAP (GTPase-activating protein) (residues 464 – 603) [15], and mouse Ect-2 (residues 495– 621) [16] were amplified by polymerase chain reaction (PCR) and fused in frame to the LexA DNA-binding domain of the yeast expression plasmid BTM116. GST-PHIP Fusion Protein—The 612-base pair (bp) fragment spanning the IRS-1 PH-binding region (PBR) of the PHIP cDNA isolated from the yeast two hybrid screen was subcloned in frame into the BamHI/EcoRI sites of pGEX-3X (Invitrogen). To prepare constructs encoding IRS-1 PHWT, a PCR-generated fragment containing the IRS-1 PH domain (residues 3–133), was subcloned into SmaI and BamHI sites within the pCGN. To generate the IRS-1 PH domain mutant constructs designated IRS-1 PHW106A, where the Trp106 residue conserved in all PH domains was changed to Ala, and either N-terminal (PHNT; residues 3– 67) or C-terminal (PHCT; residues 55–133) PH domain regions, the following primers were used to amplify the corresponding regions. To generate the pCGN/HA-DN-PHIP mutant construct, a PCR fragment of 639 bp encompassing the IRS-1 PH-binding region of PHIP (residues 4 –217) was amplified using sense primer 5Ј GGACTAGTGCGAGATTGGCTGTGGAAGAACTAAC 3Ј and antisense primer 5ЈCGGGATCCTCAGCAATATCTAGTGTCATCAACTGG 3Ј.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
