Abstract
Cionin is a homolog of vertebrate cholecystokinin/gastrin that has been identified in the ascidian Ciona intestinalis type A. The phylogenetic position of ascidians as the closest living relatives of vertebrates suggests that cionin can provide clues to the evolution of endocrine/neuroendocrine systems throughout chordates. Here, we show the biological role of cionin in the regulation of ovulation. In situ hybridization demonstrated that the mRNA of the cionin receptor, Cior2, was expressed specifically in the inner follicular cells of pre-ovulatory follicles in the Ciona ovary. Cionin was found to significantly stimulate ovulation after 24-h incubation. Transcriptome and subsequent Real-time PCR analyses confirmed that the expression levels of receptor tyrosine kinase (RTK) signaling genes and a matrix metalloproteinase (MMP) gene were significantly elevated in the cionin-treated follicles. Of particular interest is that an RTK inhibitor and MMP inhibitor markedly suppressed the stimulatory effect of cionin on ovulation. Furthermore, inhibition of RTK signaling reduced the MMP gene expression in the cionin-treated follicles. These results provide evidence that cionin induces ovulation by stimulating MMP gene expression via the RTK signaling pathway. This is the first report on the endogenous roles of cionin and the induction of ovulation by cholecystokinin/gastrin family peptides in an organism.
Highlights
Ascidians are the closest living relatives of vertebrates in the Chordata superphylum, and they provide important insights into the evolution of peptidergic systems in chordates
Synteny analysis has suggested that CCK and gastrin genes might have arisen from a common ancestral gene through a first-round whole-genome duplication event during early vertebrate e volution[20]
The present data indicated that cionin stimulates ovulation via activation of receptor tyrosine kinase (RTK) signaling pathways leading to upregulation of the expression of a matrix metalloproteinase (MMP) gene
Summary
Ascidians are the closest living relatives of vertebrates in the Chordata superphylum, and they provide important insights into the evolution of peptidergic systems in chordates. Cholecystokinin (CCK) and gastrin are a vertebrate brain/gut peptide and a gastric hormone, r espectively[20] These peptides possess a signature amino acid, a sulfated tyrosine, at positions 7 and 6 from the C-terminus, and harbor a common C-terminal amidated tetrapeptide motif (Trp-Met-Asp-Phe-NH2) that is essential for receptor activation[20]. CTCTTCCAGGGAGCGTTTGT GTGCACGCGTTTATAGCAGG TTCTGCTGGCACTCGTCAAT CCACTCGTGTTCTGCATCCT of vertebrates, the lack of a whole-genome duplication event during the evolution of Ciona[22] suggests that cionin conserves common ancestral features of CCK and gastrin. Two cognate cionin receptors, CioR1 and CioR2, have been identified[23,24] These receptors show high sequence homology to vertebrate CCK/gastrin receptors (CCK1R and CCK2R). The present study reveals a novel biological role for CCK/gastrin family peptides in the ovary, and provides clues to the evolution of the regulatory system of ovulation in chordates
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
