Abstract

Maternal smoking is a risk factor of preterm prelabor rupture of the fetal membranes (pPROM), which is responsible for 30% of preterm births worldwide. Cigarettes induce oxidative stress and inflammation, mechanisms both implicated in fetal membranes (FM) weakening. We hypothesized that the receptor for advanced glycation end-products (RAGE) and its ligands can result in cigarette-dependent inflammation. FM explants and amniotic epithelial cells (AECs) were treated with cigarette smoke condensate (CSC), combined or not with RAGE antagonist peptide (RAP), an inhibitor of RAGE. Cell suffering was evaluated by measuring lactate dehydrogenase (LDH) medium-release. Extracellular HMGB1 (a RAGE ligand) release by amnion and choriodecidua explants were checked by western blot. NF-κB pathway induction was determined by a luciferase gene reporter assay, and inflammation was evaluated by cytokine RT-qPCR and protein quantification. Gelatinase activity was assessed using a specific assay. CSC induced cell suffering and HMGB1 secretion only in the amnion, which is directly associated with a RAGE-dependent response. CSC also affected AECs by inducing inflammation (cytokine release and NFκB activation) and gelatinase activity through RAGE engagement, which was linked to an increase in extracellular matrix degradation. This RAGE dependent CSC-induced inflammation associated with an increase of gelatinase activity could explain a pathological FM weakening directly linked to pPROM.

Highlights

  • Worldwide, between 15 and 20% of pregnant women still smoke, even though smoking cigarettes is a well-known risk factor for preterm prelabor rupture of fetal membranes

  • Many pathologies are caused by cigarette-induced sterile inflammation, which can lead to lung impairments, cancer mechanisms, cardiometabolic abnormalities, as well as joint or

  • Many pathologies are caused by cigarette-induced sterile inflammation, which can lead to lung impairments, cancer mechanisms, cardiometabolic abnormalities, as well as joint or maternal-fetal disorders [2]

Read more

Summary

Introduction

Between 15 and 20% of pregnant women still smoke, even though smoking cigarettes is a well-known risk factor for preterm prelabor rupture of fetal membranes (pPROM). CSE has already shown that cigarette smoke induces OS, senescence, and apoptosis, and activates a p38 MAPK inflammatory cell pathway in FM cells, mechanisms that are implicated in tissue weakening [9,13]. The abortion of RAGE activity in mice and humans has been described as being associated with a decrease of cigarette smoke-induced inflammation in different tissues. This is the case at the pulmonary level [20,21,22], in cardiovascular diseases [23], and for intrauterine growth restriction (IUGR) syndrome in the obstetrical sphere [24]. All previous data led to our hypothesis that cigarette smoking, modeled by CSC use and focusing on RAGE activation, induces FM weakening by increasing sterile inflammation

Results
Discussion
Tissue Collection
Tissue and Cell Culture
Global Cellular Distress Determination
Western Blot Analysis of HMGB1 Release
RT-PCR and Quantitative RT-PCR on Explants and Cells
F: TGTGCTGATCCTCCCTGAGA R: TGCAGTTGGCCCCTCCTCG F: AGGCTTTAGGTATCACCACT R
Cytokine Release Assay
4.11. Gelatinase Activity Measurement
4.12. Statistical Analysis
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call