Charakterisierung des 5-HT<sub>3B</sub>-Promotors der Ratte vor dem Hintergrund eines mit Chemotherapie-induziertem Erbrechen assoziierten Polymorphismus

Abstract

5-HT3B is a subunit of the serotonin receptor type 3 (5-HT3), which is an ion channel of the cys-loop receptor family. The gene HTR3B encodes for 5-HT3B. The polymorphism -100_-102delAAG in the HTR3B promoter can affect HTR3B promoter activity and has been associated with the frequency and severity of chemotherapy-induced nausea and vomiting during antiemetic therapy with 5-HT3 receptor antagonists. So far, little is known about the mechanisms of transcriptional regulation of 5-HT3B and about the mechanism by which the -100_-102delAAG polymorphism affects HTR3B expression. The promoter of the rat Htr3B gene was characterized in the rat pheochromocytoma cell line PC-12 and in human HEK-293 cells. To this end, RACE-based transcription start site analysis, in vitro and in vivo DNA-methylation analysis, bioinformatics, DNase I hypersensitivity assays, electrophoretic mobility shift assays (EMSAs) and luciferase reporter gene assays in combination with site-directed mutagenesis and protein overexpression were used. To identify the proteins that bind in the -100_-102delAAG region, EMSAs and affinity capture linked with mass spectrometry analysis were used. The rat Htr3B gene has multiple transcription start sites (TSS), but no canonical core promoter elements. One TSS, at -109 bp from the translational start codon, is highly evolutionary conserved between human and rat. Mutations in the -109 bp region result in a decrease of Htr3B promoter activity of about 68%. A CpG island was identified in the Htr3B promoter region. However, the CpG island seems to have no impact on Htr3B transcription initiation. A transcriptionally relevant evolutionary conserved region (ECR) was identified about 1.5 kb upstream of the ATG start codon. The proximal promoter region starts at -445 bp of the ATG start codon. Three trans-regulatory elements were identified in the proximal Htr3B promoter region; the transcription factors USF1 (Upstream Stimulatory Factor 1), YY1 (Ying Yang 1) and NF-1 (Nuclear Factor-1). USF1 binds to an E-box between -183 to -178 bp of the ATG start codon. Mutation of the USF1 binding sequence in the -258 bp promoter fragment resulted in a decrease of promoter activity of about 55%. Overexpression of USF1 resulted in a significant increase of promoter activity of the native, but not of the E-box-mutated promoter. YY1 binds between -284 to -269 bp and -266 to -252 bp at the Htr3B promoter. NF-1 binds between -267 to -253 bp. At the human HTR3B P1 promoter, in the region of the -100_-102delAAG polymorphism, the sequence GGAGAAGGAGGAGAACAGAGTG was determined to be essential for protein binding. Four proteins that potentially may bind to it were identified: ZNF207 (Zinc finger protein 207), hnRNP U (Heterogeneous nuclear ribonucleoprotein U), SFPQ (Splice factor, proline- and glutamine-rich) and NonO (Non-POU domain-containing octamer-binding protein). Sequence analysis and EMSAs support the possibility of binding of SFPQ and NonO to the -100_-102delAAG region. In conclusion, transcription of the rat Htr3B gene is initiated via multiple transcription start sites and regulated via USF1, YY1 and NF-1. Transcription initiation is independent of DNA methylation. Potential binding sites for YY1 and NF-1 also exist in the human HTR3B promoters, but they are not involved in the effects of the -100_-102delAAG polymorphism.