Abstract
Pyridoxine dependent epilepsy (PDE) is caused by likely pathogenic variants in ALDH7A1 (PDE-ALDH7A1) and inherited autosomal recessively. Neurotoxic alpha-amino adipic semialdehyde (alpha-AASA), piperideine 6-carboxylate and pipecolic acid accumulate in body fluids. Neonatal or infantile onset seizures refractory to anti-epileptic medications are clinical features. Treatment with pyridoxine, arginine and lysine-restricted diet does not normalize neurodevelopmental outcome or accumulation of neurotoxic metabolites. There is no animal model for high throughput drug screening. For this reason, we developed and characterized the first knock-out aldh7a1 zebrafish model using CRISPR-Cas9 technology. Zebrafish aldh7a1 mutants were generated by using a vector free method of CRISPR-Cas9 mutagenesis. Genotype analysis of aldh7a1 knock-out zebrafish was performed by high resolution melt analysis, direct sequencing and QIAxcel system. Electroencephalogram was performed. Alpha-AASA, piperideine 6-carboxylate and pipecolic acid, were measured by liquid chromatography-tandem mass spectrometry. Our knock-out aldh7a1 zebrafish has homozygous 5 base pair (bp) mutation in ALDH7A1. Knock-out aldh7a1 embryos have spontaneous rapid increase in locomotion and a rapid circling swim behavior earliest 8-day post fertilization (dpf). Electroencephalogram revealed large amplitude spike discharges compared to wild type. Knock-out aldh7a1 embryos have elevated alpha-AASA, piperideine 6-carboxylate and pipecolic acid compared to wild type embryos at 3 dpf. Knock-out aldh7a1 embryos showed no aldh7a1 protein by western blot compared to wild type. Our knock-out aldh7a1 zebrafish is a well characterized model for large-scale drug screening using behavioral and biochemical features and accurately recapitulates the human PDE-ALDH7A1 disease.
Highlights
Pyridoxine dependent epilepsy (PDE) (OMIM#266100) caused by likely pathogenic variants in ALDH7A1 (PDE-ALDH7A1) (GenBank accession nos: GI319655560 GI320202963 and GI319655559) is an autosomal recessively inherited neurometabolic disease [1,2]
There is a single copy of aldh7a1 in zebrafish. guide RNA (gRNA) and Cas9 RNA were injected into 1 cell stage embryos
The resulting F1 offspring were raised to adulthood. Screening by both high-resolution melt (HRM) and Sanger sequencing, we identified F1 carriers with the following mutations: a 5bp deletion (AGAGG), an 11bp deletion (GAGAGGGG AAA), and a 21bp insertion (AAATTGTTCGACAATTTTTGA).We incrossed F1 carriers with the 5bp deletion to generate the F2 generation zebrafish
Summary
Pyridoxine dependent epilepsy (PDE) (OMIM#266100) caused by likely pathogenic variants in ALDH7A1 (PDE-ALDH7A1) (GenBank accession nos: GI319655560 GI320202963 and GI319655559) is an autosomal recessively inherited neurometabolic disease [1,2]. Lysine-restricted diet and arginine to treat seizures and decrease accumulation of CSF alpha-AASA, P6C and PA to improve neurodevelopmental outcome [4,6,7,8,9,10]. This treatment was not successful to normalize accumulation of CSF alpha-AASA, P6C and PA or neurodevelopmental outcome in any of the patients so far [6,7,9,10]
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
