Abstract

A cDNA, p1-88, was cloned from a library constructed using rabbit liver mRNA. Sequence analysis indicates that p1-88 is highly similar (congruent to 95%) to the cDNA, p1-8, that encodes rabbit liver cytochrome P-450 1 and that had been isolated from the same library. The predicted amino acid sequence of the protein encoded by p1-88, P-450 IIC4, differs at 25 of 487 amino acids from that encoded by p1-8. P-450 IIC4 was synthesized in vitro using rabbit reticulocyte lysate primed with RNA transcribed from the coding sequence of p1-88 using a bacteriophage T7 RNA polymerase/promoter system. P-450 IIC4 reacts with two monoclonal antibodies that recognize P-450 1 and exhibits the same relative electrophoretic mobility as P-450 1. In contrast, the reactivity of a third monoclonal antibody recognizing P-450 1, 1F11, toward P-450 IIC4 synthesized in vitro is greatly diminished. The latter antibody extensively inhibits hepatic progesterone 21-hydroxylase activity and recognizes phenotypic differences among rabbits in the microsomal concentration of P-450 1. This difference in the immunoreactivity of P-450 IIC4 and P-450 1 with the 1F11 antibody suggests that P-450 IIC4 does not contribute significantly to hepatic progesterone 21-hydroxylase activity. S1 nuclease mapping demonstrates that the expression of mRNAs corresponding to p1-88 are expressed to equivalent extents in rabbits exhibiting high and low expression of mRNAs corresponding to p1-8. Thus, P-450 1 differs from the protein encoded by p1-88, in its regulation, immunoreactivity, and by inference its catalytic properties although the amino acid sequences of P-450 1 and P-450 IIC4 are highly similar (congruent to 95%).

Highlights

  • From the Division of Biochemistry, Department of Basic and Clinical Research, Scripps Clinic and Research Foundation, La Jollq California 92037

  • The resultspresented here indicate that a second gene closely related to thatencoding P-450 1is expressed in rabbit liver

  • In contrastto P-450 1,mRNAs coding for P-450 IIC4 are not expressed at different steady-state concentrations i2n1H and 21L rabbits as judged from S1 nuclease mapping experiments

Read more

Summary

RESULTS

Initiation codon of the inserts and the latteris not conserved in the construction. The initiation codon of each was reconstructed by. The 3' PstI fragment of the P-450 1 cDNA, pl-8, was insertion [15] of a CslaI linker, 5'-d[CATCGATG]-3', into theBarnHI labeled with 32Pby nick translation and used to screen the site after filling in the 3' recessed ends using Klenow fragment. PT7-88 and pT7-8, contained theentire were colony purified from an estimated 5000 recombinants coding region and 3' untranslated regions of the respective cDNAs as well as 23 base pairs of pBR322 DNA proximal to the 3' end of the cDNA insert. Two hypervariable regions beginningat nucleotide 337 and at 1636 that are sites of S1 nuclease cutting in mapping experiments described in the text are shown in bold face.The sequence was determined bythe dideoxy chain termination procedure [8]using a strategy similarto that reported earlier for pl-8 [6].

61 CCTGGTGTTGGGGCTCTGCTGTTTACTTCTCCTTTCACTTCCGGGAG
I I T7-8 T7-88
Findings
DISCUSSION
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call