Abstract
It has been known for a long time that the yeast Saccharomyces cerevisiae can assimilate alpha-methylglucopyranoside and isomaltose. We here report the identification of 5 genes (YGR287c, YIL172c, YJL216c, YJL221c and YOL157c), which, similar to the SUCx, MALx, or HXTx multigene families, are located in the subtelomeric regions of different chromosomes. They share high nucleotide sequence identities between themselves (66-100%) and with the MALx2 genes (63-74%). Comparison of their amino acid sequences underlined a substitution of threonine by valine in region II, one of the four highly conserved regions of the alpha-glucosidase family. This change was previously shown to be sufficient to discriminate alpha-1,4- to alpha-1,6-glucosidase activity in YGR287c (Yamamoto, K., Nakayama, A., Yamamoto, Y., and Tabata, S. (2004) Eur. J. Biochem. 271, 3414-3420). We showed that each of these five genes encodes a protein with alpha-glucosidase activity on isomaltose, and we therefore renamed these genes IMA1 to IMA5 for IsoMAltase. Our results also illustrated that sequence polymorphisms among this family led to interesting variability of gene expression patterns and of catalytic efficiencies on different substrates, which altogether should account for the absence of functional redundancy for growth on isomaltose. Indeed, deletion studies revealed that IMA1/YGR287c encodes the major isomaltase and that growth on isomaltose required the presence of AGT1, which encodes an alpha-glucoside transporter. Expressions of IMA1 and IMA5/YJL216c were strongly induced by maltose, isomaltose, and alpha-methylglucopyranoside, in accordance with their regulation by the Malx3p-transcription system. The physiological relevance of this IMAx multigene family in S. cerevisiae is discussed.
Highlights
BankTM/EBI Data Bank with accession number(s) HM74861–HM74865. 1 To whom correspondence should be addressed: INSA-LISBP, 135 Ave. de
Our results showed that yeast is endowed with the presence of five genes encoding four distinct isomaltases, all located in the subtelomeric regions of different chromosomes
The Expression of the IMAx Genes Is Regulated by Carbon Sources—Because growth on isomaltose relied on a MAL23 activator, we investigated whether the expression of this multigene family is under the control of the MAL-regulatory system and is regulated by the nature of the carbon source, as is the case for MALx genes [36]
Summary
GCGGATCCGTCATCCACTACTCTCCCTCCTGAG R: GCACCGGTCTATCAGTATATCTATCTCGTATAAGTGAACGGCG F: CGAATATTCATTCAGTCGGACCG R: CGGCCACCATCTCATTCTTTACTAG F: GAAGGTTTTGTGAAGTGTCAGGGAAATGC R: GAAGCCCATTTTCTACCTCCATCACCGTAC F: AGAAGCGTTCGGAAATTCCAAAAC R: TTTGTTAAGAACAAGGCCTGCACC F: TAATTTTTGTGGGGAACTGAACAAGGTCA R: CGAACCGGTGAATATATTTTGCTGGCTAGAT F: CGGGATCCATGACTATTTCTGATCATCC R: GGCATGCATTTATTTGACGAGGTAGATTCT F: GCCAGATCTATGACTATTTCTTCTGCACATCCAG R: GCCCTGCAGTCATTCGCTGATATATATTCTTCCTTC F: CGGGATCCATGACTATTTCTTCTGCACATCCAGAAA R: TGCATGCATTCATTCAGATATGTAAATTCTGCCCTCC F: CGGGATCCATGACGATCATCCATAATCCT R: GGCCTGCAGTTACTTCAACAAGTAAAGTCTTC F: GGAAGATCTATGACTATTTCTTCTGCACATCCAGAA R: GCCTGCAGTCATTCAGATATGTAAATTCTGCCCTC. Khan and Haynes showed that the products of the MGL1 and MGL3 genes have the same phenotypic function, molecular weight, and substrate specificity (isomaltose and ␣MG), but differ with respect to their specific activity and Michaelis constant [21]. Our results showed that yeast is endowed with the presence of five genes encoding four distinct isomaltases, all located in the subtelomeric regions of different chromosomes. We report here a complete functional genomic analysis of these five genes, including their respective role in isomaltose and ␣MG assimilation, their regulation by carbon sources, and their substrate specificities. We have renamed these genes IMAx (IMA1 through IMA5) for IsoMAltase
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
