Abstract
Low stringency screening of a human P1 artificial chromosome library using a human hair keratin-associated protein (hKAP1.1A) gene probe resulted in the isolation of six P1 artificial chromosome clones. End sequencing and EMBO/GenBank(TM) data base analysis showed these clones to be contained in four previously sequenced human bacterial artificial chromosome clones present on chromosome 17q12-21 and arrayed into two large contigs of 290 and 225 kilobase pairs (kb) in size. A fifth, partially sequenced human bacterial artificial chromosome clone data base sequence overlapped and closed both of these contigs. One end of this 600-kb cluster harbored six gene loci for previously described human type I hair keratin genes. The other end of this cluster contained the human type I cytokeratin K20 and K12 gene loci. The center of the cluster, starting 35 kb downstream of the hHa3-I hair keratin gene, contained 37 genes for high/ultrahigh sulfur hair keratin-associated proteins (KAPs), which could be divided into a total of 7 KAP multigene families based on amino acid homology comparisons with previously identified sheep, mouse, and rabbit KAPs. To date, 26 human KAP cDNA clones have been isolated through screening of an arrayed human scalp cDNA library by means of specific 3'-noncoding region polymerase chain reaction probes derived from the identified KAP gene sequences. This screening also yielded four additional cDNA sequences whose genes were not present on this gene cluster but belonged to specific KAP gene families present on this contig. Hair follicle in situ hybridization data for single members of five different KAP multigene families all showed localization of the respective mRNAs to the upper cortex of the hair shaft.
Highlights
The mature hair fiber is made up mainly of two major cell types
The PAC clones isolated lead to the identification of contiguous DNA sequences in the EMBO/GenBankTM containing 37 genes for high and ultrahigh sulfur keratinassociated proteins (KAPs), which could be classified into seven KAP multigene families. cDNA transcripts of 30 KAP genes from these families were isolated from an arrayed human scalp cDNA library
DNA end sequences derived from each of these clones were compared with sequences in the EMBO/GenBankTM data base, which resulted in the identification of four fully sequenced BAC clones, AC003958, AC006070, AC007455, and AC00423, representing two DNA contigs on chromosome 17q12-21
Summary
KAP1.3–3Ј KAP1.4–3Ј KAP2.2–3Ј KAP2.3–3Ј KAP2.4–3Ј ⌿KAP2A-3Ј KAP3.1–3Ј KAP3.2–3Ј KAP3.3–3Ј ⌿KAP3A-3Ј KAP4.1–3Ј KAP4.3–3Ј KAP4.4–3Ј KAP4.5–3Ј KAP4.5–2-3Ј KAP4.6–3Ј KAP4.7–3Ј KAP4.11–3Ј KAP4.12–3Ј ⌿KAP4A-3Ј KAP9.1–3Ј KAP9.7–3Ј ⌿KAP9A-3Ј KAP16.1–3Ј KAP-Tyr/Glyϩ agccagtttgctgattttca ggtaacccccataagaaagaca cttaagaatgaaaggggaagca gggagcagagatgtcactga gagcagcccgttatca ggtgtcttcaatgcatagtg ccctcaacgcacgaaac atgtggggaaatagataggatg ccacagagcaatacactgaagc ttgcaaaagatgatggtgaca accaccttgttgtcagtgta gcaaagtccagaccaca caatgtcctctgcaccat tcaaagagtgatgaaatagcct ttcagtattcacttgcctcagt cattcacctgcccacag catagaagctttagcattcacc ccaaaccacccacagaa acctgcatccagagtgtga tttttcccatttctcattgtaa ccatcagctttattatcctg tcagaaacttagaggcttagtc atttctagttgctgtcatccc gatactctgtgcctgaactgaa ctcaccagattctcatcaac tcagagcaaattacaacttatg cccttgtgctgtgcctcc attggggcctggcataacat cctgccagtttgtctcat agatcacagttagtgtccc ccccttcagctcactcctcac ctgcaagaatttccgtgtttgg caactggcccacagatgtagac tgccaccaccagaagaaaaaga tttaaatcgttttgagcctaca cagggagaaagcaggaga cttattacgtcctttcctacag gaaggaagggagtttgg gttcccctccctttctt tatgcaggaggtttattgaa ccaccacccaccagaga gagggaatgaagaagaatgaaa cccacgagtgtctacctg aagttcaccctaagttcacttt aactctccagaggaccaccatc tgaagtactctgccctccctca cggcttacccctcaaagaa aaagagacccgagatgatgtgg aactactacggcaacttctgtg tgattgacttccgcaactgta bp °C. KAP17.1 expression of the respective mRNAs in the differentiated portion of the hair cortex
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
