Characterization, cloning, and in vitro expression of the extremely thermostable glutamate dehydrogenase from the hyperthermophilic Archaeon, ES4.

J Diruggiero,F.T Robb,R Jagus,H.H Klump,K.M Borges,M Kessel,X Mai,M.W Adams

doi:10.1016/s0021-9258(17)46771-8

J Diruggiero, F.T Robb + Show 6 more

Open Access

https://doi.org/10.1016/s0021-9258(17)46771-8

Copy DOI

Abstract

Glutamate dehydrogenase (GDH) from the hyperthermophilic Archaeon ES4 (optimal growth temperature 98 degrees C and maximum growth temperature 110 degrees C) was purified to homogeneity. The purified native enzyme had an M(r) of 270,000 +/- 5,000 and was shown by gel filtration and SDS-polyacrylamide gel electrophoresis to be a hexamer with identical subunits of M(r) = 46,000 +/- 3,000. The hexameric subunit composition was also evident from electron micrographs, which show a triangular antiprism structure very similar to that of bovine GDH. The enzyme is exceptionally thermostable, with a half-time of inactivation of 3.5 h at 105 degrees C. Differential scanning calorimetry revealed a tm for denaturation of 113 degrees C, and a tm for activation at 60 degrees C. Antigenic cross-reaction with ES4 GDH was observed with the purified GDH from the thermophilic Archaea, Pyrococcus furiosus and Thermococcus litoralis as well as with bovine and yeast GDHs. The genome of ES4 was shown to contain a single copy of the gdhA gene, and this was cloned and sequenced. The deduced amino acid sequence of the GDH from ES4 corresponded to the NH2-terminal amino acid sequence obtained from the pure protein. From the nucleotide sequence the ES4 protein is composed of 420 residues. It has a relatively high hydrophobicity and a low number of sulfur-containing residues compared with mesophilic GDHs. Relatively high homology (52%) exists between the deduced amino acid sequence of ES4 GDH and Clostridium difficile GDH. Of the two distinct families of GDH sequences known, ES4 GDH belongs to the same family as vertebrates, C. difficile, and other Archaea. The gdhA gene of ES4 was expressed in vitro in a rabbit reticulocyte cell-free lysate, thus providing a system for structural studies of the mechanisms of thermostability in hyper-thermophilic proteins.

Highlights

Characterization, Cloning, and in Vitro Expression of the Extremely Thermostable Glutamate Dehydrogenasefrom the Hyperthermophilic Archaeon, ES4*
In order t o investigate some of the metabolic properties of hyperthermophiles and mechanisms of protein “hyperthermostability,” we have focused on glutamate dehydrogenase (EC 1.4.1.3, Glutamate dehydrogenase (GDH)),’ which utilizes the nicotinamide-dependent oxidation of glutamate to a-oxoglutarate
This paper describes the purification, cloning, and expression for the first time of a thermostable GDH froma hyperthermophile with a maximal growth temperature of 110 "C (3)

Summary

MATERIALS AND METHODS

A gel filtration step using a Superdex 200 column Cloning and Sequencing-Genomic DNA from ES4 was partially (6 X 60 cm), equilibrated a t 4 ml/min with 50 mM Tris,pH 8, digested with BamHI and therestriction fragments, with a size range containing 2mM sodium dithionite, 2mM dithiothreitol, 1mM MgCl,, of 14-20 kb, were cloned into thelambda Fix vector (Stratagene, CA). These and all subsequent columns were controlled chain reaction fragment of the ES4 gdhA gene obtained from the by aPharmaciafastprotein liquid chromatography system. Microcalorimetry and Thermostability Determination-For deter- products were determined by chromatography on a calibrated Sephmination of the thermostability of ES4 GDH at high temperatures, 1 acryl S-200 column (0.5 X 12 cm) (Pharmacia)and scintillation mg/mIof the purified enzyme in 20mM Tris-HC1 buffer, pH 7.6, counting. Tubes wereremoved at hourly intervals, chilled on ice, centrifuged briefly, and sampled for enzyme

RESULTS

EcoRl Hael Hindlll Accl c

DISCUSSION

KH AAG CAC TGATTTTCTTGCCTCTTCCCTTTCTGCTTTATTCTGTATG

Findings

This attests to pthresence of highly conserved regions among