Abstract

We have cloned the gene for human interstitial retinol-binding protein (IRBP) and compared its nucleotide sequence with that of the corresponding cloned cDNA. The human IRBP gene is approximately 9.5 kilobase pairs (kbp) in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. This unusual structure is shared with the bovine IRBP gene. A large (1.7 kbp) fragment appears to have been lost from the 3'-noncoding region of the last human exon. We conclude that the human and bovine genes have similar evolutionary histories.

Highlights

  • We have cloned the gene for human interstitial retinol-binding protein (IRBP) and compared its nucleotide sequence with that of the corresponding cloned cDNA

  • Interstitial retinol-binding protein (IRBP)’ is an elongated glycoprotein found in the eyes of all vertebrates (l-8)

  • IRBP binds two molecules of alltruns- or 11-cis-retinol [3, 7], and we have suggested that hydrophobic amino acids in the four homologous regions of the molecule participate in the formation of two folding domains that constitute two retinol-binding sites [23]

Read more

Summary

PROCEDURES

Isolation of Genomic Clone for Human IRBP-The isolation of a genomic clone (HGL.3) containing the full coding region of IRBP has been described [22]. A 1.5-kilobase pair SstI fragment from clone HGL.l was used to provide information on the gene sequence beyond the 3’-end of clone HGL.. Primer Extension-A synthetic 23-base oligonucleotide complementary to residues -58 to -80 of human IRBP cDNA [22] was used as a primer. The 32P-labeled synthetic oligonucleotide used for primer extension was hybridized to a 2.4-kb SstI IRBP genomic fragment, the 3’-end of which is located at nucleotide 367 on the genomic sequence obtained in this work. The singlestranded radiolabeled probe, defined at its 3’-end by the HgiAI digestion, was isolated on an alkaline agarose gel and hybridized (5 x lo cpm) with 50 rg of human retina total RNA. Five hundred units of Sl nuclease were added, and the size of the protected probe was determined on an 8% denaturing polyacrylamide gel

Corrections to published human IRBP cDNA
GT GCA CCCCACCTTCCTTCTTCATACTTTGCTCTCTT
RESULTS AND DISCUSSION
Intron size b
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.