Abstract
In Dictyostelium discoideum counting factor (CF), a secreted approximately 450-kDa complex of polypeptides, inhibits group and fruiting body size. When the gene encoding countin (a component of CF) was disrupted, cells formed large groups. We find that recombinant countin causes developing cells to form small groups, with an EC(50) of approximately 3 ng/ml, and affects cAMP signal transduction in the same manner as semipurified CF. Recombinant countin increases cell motility, decreases cell-cell adhesion, and regulates gene expression in a manner similar to the effect of CF. However, countin does not decrease adhesion or group size to the extent that semipurified CF does. A 1-min exposure of developing cells to countin causes an increase in F-actin polymerization and myosin phosphorylation and a decrease in myosin polymerization, suggesting that countin activates a rapid signal transduction pathway. (125)I-Labeled countin has countin bioactivity, and binding experiments suggest that vegetative and developing cells have approximately 53 cell-surface sites that bind countin with a K(D) of approximately 1.5 ng/ml or 60 pm. We hypothesize that countin regulates cell development through the same pathway as CF and that other proteins within the complex may modify the activity of countin and/or have independent size-regulating activities.
Highlights
The mechanisms multicellular organisms use to form tissues of a genetically predetermined specific size are poorly understood [1, 2]
We expressed the countin polypeptide backbone in bacteria and found that it could be purified to a 27-kDa band that stained with anti-countin antibodies (Fig. 1)
Countin Has Some counting factor (CF) Activity—We have found here that the bacterially synthesized polypeptide backbone of countin appears to have the biological activity of the entire complex
Summary
Preparation of Recombinant Countin—A PCR was performed using the primers CCCCATGGACCATATGCTCGACTCATGTAGTATT and CCGGATCCTTAAAATAAAGCAAAACCTGA with the Advantage 2 PCR kit (CLONTECH, Palo Alto, CA) and a Dictyostelium developmental cDNA library as the template. The denatured recombinant countin was clarified at 20,000 ϫ g for 10 min at room temperature; the supernatant was mixed with the nickel-cheated agarose, and bound protein was purified following the manufacturer’s directions with the exception that 4 M urea was added to the washing and elution buffers. Myosin polymerization and phosphorylation were measured following Tang et al [40] with the exception that for the phosphorylation assays cells were resuspended in the myosin polymerization lysis buffer to 5 ϫ 107 cells/ml, mixed with an equal volume of 2ϫ Laemmli sample buffer, boiled for 3 min, and electrophoresed on a SDS-polyacrylamide gel. 2 l of the purified 125I-countin was added to 10 ml of Bio-Safe II liquid scintillant (Research Products International, Mount Prospect, IL) and analyzed in an LS 6500 scintillation counter (Beckman Instruments, Fullerton, CA)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
