Abstract

Serum amyloid A (SAA) is a major acute phase protein involved in multiple physiological and pathological processes. This study provides experimental evidence that CD36, a phagocyte class B scavenger receptor, functions as a novel SAA receptor mediating SAA proinflammatory activity. The uptake of Alexa Fluor 488 SAA as well as of other well established CD36 ligands was increased 5-10-fold in HeLa cells stably transfected with CD36 when compared with mock-transfected cells. Unlike other apolipoproteins that bind to CD36, only SAA induced a 10-50-fold increase of interleukin-8 secretion in CD36-overexpressing HEK293 cells when compared with control cells. SAA-mediated effects were thermolabile, inhibitable by anti-SAA antibody, and also neutralized by association with high density lipoprotein but not by association with bovine serum albumin. SAA-induced cell activation was inhibited by a CD36 peptide based on the CD36 hexarelin-binding site but not by a peptide based on the thrombospondin-1-binding site. A pronounced reduction (up to 60-75%) of SAA-induced pro-inflammatory cytokine secretion was observed in cd36(-/-) rat macrophages and Kupffer cells when compared with wild type rat cells. The results of the MAPK phosphorylation assay as well as of the studies with NF-kappaB and MAPK inhibitors revealed that two MAPKs, JNK and to a lesser extent ERK1/2, primarily contribute to elevated cytokine production in CD36-overexpressing HEK293 cells. In macrophages, four signaling pathways involving NF-kappaB and three MAPKs all appeared to contribute to SAA-induced cytokine release. These observations indicate that CD36 is a receptor mediating SAA binding and SAA-induced pro-inflammatory cytokine secretion predominantly through JNK- and ERK1/2-mediated signaling.

Highlights

  • During infection, acute inflammation, trauma, neoplastic growth, or any other tissue damage in general, the host undergoes a series of biochemical and physiological changes known as the acute phase response (APR),3 a reaction that plays a critical role in the innate immune response to tissue injury [1]

  • Uptake of Alexa Fluor 488-labeled Serum amyloid A (SAA) Is Enhanced in hCD36-transfected Versus Mock-transfected HeLa Cells—Consistent with the well established role of CD36 as a receptor for native lipoproteins [68] as well as for modified low density lipoprotein (LDL) [48], our FACS analyses demonstrated that the uptake of Alexa Fluor 488-labeled high density lipoprotein (HDL) (ϳ4-fold increase), LDL (ϳ6-fold increase), and oxidized LDL (oxLDL) (ϳ5-fold increase) was increased in CD36-overexpressing HeLa cells when compared with mock-transfected cells (Fig. 2)

  • As could be predicted from the presence of ␣-helical motifs in apolipoproteins A-I (apoA-I) and apoA-II, both apolipoproteins appeared to be CD36 agonists, as CD36overexpressing cells demonstrated an ϳ10-fold increase in uptake for these apolipoproteins when compared with mocktransfected cells

Read more

Summary

EXPERIMENTAL PROCEDURES

Reagents—All media, serum preparations, cell trackers, reactive fluorescent dyes and antibiotics were obtained from Invitrogen. Puromycin-resistant cells were screened for the expression of the human CD36 protein utilizing mouse anti-hCD36 antibody (Abcam, Cambridge, MA) in Western blotting. Nonattached cells were removed from the culture plates by extensive washing, and the KC were further cultivated in RPMI 1640 medium containing 10% FCS and 10 ng/ml macrophage colony-stimulating factor. Competition Studies with Alexa Fluor 488 SAA—CD36-overexpressing HeLa cells grown in 24-well plates were incubated with 5 ␮g/ml Alexa Fluor 488 SAA without or with increasing concentrations of unlabeled ligands at 37 °C for 2 h, washed three times with phosphate-buffered saline, and detached from the plate surface by incubation in 200 ␮l of Cellstripper solution for 30 min at room temperature with continuous rocking on Rocker II (Boekel Scientific). Cytokine Secretion Analyses—Cytokine secretion was analyzed in culture supernatants after a 20-h period of incubation in serum-free media with or without BSA (2 mg/ml) utilizing commercial enzyme-linked immunosorbent assay kits for human IL-8 (Invitrogen), rat IL-6, and rat TNF-␣ (Pierce) following the manufacturer’s instructions. RNA samples were reverse-transcribed by Moloney murine leukemia virus reverse

GCTGCCTAAATGCCTCAGGGGATTAAAGCTCAG ACGGTGAGGAGTATTCTGACGG
RESULTS
DISCUSSION
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call