Abstract
Caveolin-1 (CAV1) is the structural protein of the filamentous coat that decorates the cytoplasmic surface of each caveola. Cell culture studies have implicated CAV1 in playing an important role in intracellular cholesterol trafficking. In addition, it has been reported that CAV1 forms a detergent-resistant protein complex with Annexin-2 in enterocytes that can be disrupted by the cholesterol absorption inhibitor ezetimibe, suggesting a possible role for CAV1 in cholesterol absorption. In this report, we have evaluated cholesterol homeostasis in Cav1 knock-out mice. Deletion of CAV1 does not result in either a compensatory increase of CAV2 or CAV3 in intestine. In addition, Cav1 knock-out mice display normal mRNA and protein levels of Annexin-2 or the putative cholesterol transport protein Niemann-Pick C1-like 1 (NPC1L1) in proximal intestinal mucosa. Fractional cholesterol absorption and fecal neutral sterol excretion are statistically similar in Cav1 knock-out mice and their wild-type littermates. Moreover, oral administration of ezetimibe is equally effective in decreasing cholesterol absorption in Cav1 null mice and wild-type controls. The mRNA expression levels of genes sensitive to intracellular cholesterol concentration (ATP-binding cassette transporters ABCA1 and ABCG5, hydroxymethylglutaryl-CoA synthase and the LDL receptor) are similarly altered in the proximal intestinal mucosa of Cav1 null and wild-type mice following ezetimibe treatment. These results demonstrate that CAV1 is not required for cholesterol absorption or ezetimibe sensitivity in the mouse.
Highlights
Ezetimibe is a member of the 2-azetidinone class of drugs that has recently been approved for clinical use in reducing plasma cholesterol levels [1]
To investigate the role of CAV1 in cholesterol homeostasis, we evaluated a number of metabolic parameters indicative of cholesterol absorption and trafficking in intact mice
CAV3 mRNA was undetectable (CT Ͼ 35 cycles) in liver. These results suggest that the mild to absent hepatic phenotype in the Cav1 null mouse is not because of a compensatory increase of another caveolin family member
Summary
Cav1-deficient mice were generated by gene deletion of exon 2 as described previously [18]. Mouse genotyping was performed by PCR using the primers F1, 5Ј-ttctgtgtgcaagcctttcc; R1, 5Ј-gtgtgcgcgtcatacacttg; and R2, 5Јggggaggagtagaaggtggc to generate a product of 307 bp for the null allele and 260 bp for the wild-type allele [18]. It has been reported that older Cav null mice are smaller than wild-type mice [19], the mice used in these studies showed no difference in body weight (WT, 26.65 Ϯ 2.79; WT-EZ, 29.48 Ϯ 3.2; Cav knock-out, 30.58 Ϯ 1.57; Cav knock-out-EZ, 30.76 Ϯ 1.59 g). The mice were fed the powdered form of this diet, which in some experiments was supplemented with ezetimibe to provide 10 mg/day/kg of body weight (based on the consumption of 160 g of diet/ day/kg of body weight). Experiments were performed at the end of the dark cycle, and mice were in a fed-state at the time of study.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
