Cadmium Induces Retinoic Acid Signaling by Regulating Retinoic Acid Metabolic Gene Expression

Yuxia Cui,Jonathan H Freedman

doi:10.1074/jbc.m109.026609

Abstract

The transition metal cadmium is an environmental teratogen. In addition, cadmium and retinoic acid can act synergistically to induce forelimb malformations. The molecular mechanism underlying the teratogenicity of cadmium and the synergistic effect with retinoic acid has not been addressed. An evolutionarily conserved gene, beta,beta-carotene 15,15'-monooxygenase (BCMO), which is involved in retinoic acid biosynthesis, was studied in both Caenorhabditis elegans and murine Hepa 1-6 cells. In C. elegans, bcmo-1 was expressed in the intestine and was cadmium inducible. Similarly, in Hepa 1-6 cells, Bcmo1 was induced by cadmium. Retinoic acid-mediated signaling increased after 24-h exposures to 5 and 10 microm cadmium in Hepa 1-6 cells. Examination of gene expression demonstrated that the induction of retinoic acid signaling by cadmium may be mediated by overexpression of Bcmo1. Furthermore, cadmium inhibited the expression of Cyp26a1 and Cyp26b1, which are involved in retinoic acid degradation. These results indicate that cadmium-induced teratogenicity may be due to the ability of the metal to increase the levels of retinoic acid by disrupting the expression of retinoic acid-metabolizing genes.

Highlights

The transition metal cadmium is a persistent toxicant that exists ubiquitously in the environment
Cadmium inhibited the expression of Cyp26a1 and Cyp26b1, which are involved in retinoic acid degradation. These results indicate that cadmium-induced teratogenicity may be due to the ability of the metal to increase the levels of retinoic acid by disrupting the expression of retinoic acid-metabolizing genes
Maternal exposure to cadmium in rodents causes a spectrum of birth defects, including fetal limb malformations, hydrocephalus, cleft palate, and neural tube defects, depending on the dose and the embryonic stage of development at the time of exposure (7, 9 –11)

Summary

CAAAAGTAAATGCTTCATTTTTCTGC GGACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCATT

TCAGCTTCCATTTTTTAGAACA TTTTTCTGCAAAATATCGAGCG ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCC CCACTGAGCCTCAAACCCAAACCTTCTTCCG ATCTTTCTTGCATCGTGCTCATC suggested that cadmium and RA may share a common teratogenic mechanism, the molecular mechanism for the interactive effects has not been fully addressed [23, 27]. In our previous study of cadmium-regulated transcription in the nematode Caenorhabditis elegans, an evolutionarily conserved gene, Y46G5A.24, which encodes the nematode homolog of mammalian ␤,␤-carotene 15,15Ј-monooxygenase (BCMO), was found to be highly cadmium-responsive [28]. The predicted C. elegans protein encoded by Y46G5A.24, designated bcmo-1, shares Ͼ95% sequence identity with the human (BCMO1) and mouse (Bcmo1) homologs. We show that bcmo-1 and the murine homolog are cadmium-responsive. Cadmium affects other components in RA metabolism in mouse cells. Based on these results a mechanism for cadmium teratogenicity is proposed in which cadmium exposure causes an increase in the levels of RA by increasing RA synthesis and decreasing RA degradation, which subsequently leads to developmental abnormalities

EXPERIMENTAL PROCEDURES

RESULTS

DISCUSSION