Abstract
Polyhydroxyalkanoates (PHAs) can be catabolized by many microorganisms using intra- or extracellular PHA depolymerases. Most of our current knowledge of these intracellular enzyme-coding genes comes from the analysis of short chain length PHA depolymerases, whereas medium chain length PHA (mcl-PHA) intracellular depolymerization systems still remained to be characterized. The phaZ gene of some Pseudomonas putida strains has been identified only by mutagenesis and complementation techniques as putative intracellular mcl-PHA depolymerase. However, none of their corresponding encoded PhaZ enzymes have been characterized in depth. In this study the PhaZ depolymerase from P. putida KT2442 has been purified and biochemically characterized after its overexpression in Escherichia coli. To facilitate these studies we have developed a new and very sensitive radioactive method for detecting PHA hydrolysis in vitro. We have demonstrated that PhaZ is an intracellular depolymerase that is located in PHA granules and that hydrolyzes specifically mcl-PHAs containing aliphatic and aromatic monomers. The enzyme behaves as a serine hydrolase that is inhibited by phenylmethylsulfonyl fluoride. We have modeled the three-dimensional structure of PhaZ complexed with a 3-hydroxyoctanoate dimer. Using this model, we found that the enzyme appears to be built up from a corealpha/beta hydrolase-type domain capped with a lid structure with an active site containing a catalytic triad buried near the connection between domains. All these data constitute the first biochemical characterization of PhaZ and allow us to propose this enzyme as the paradigmatic representative of intracellular endo/exo-mcl-PHA depolymerases.
Highlights
PHAs can be catabolized by many microorganisms through extracellular or intracellular processes depending on the PHA localization [6]
The first report describing a process of mclPHA mobilization demonstrated the existence of self-hydrolysis of the granules in a strain of Pseudomonas oleovorans [15, 28], whereas an medium chain length PHA (mcl-PHA) intracellular depolymerase activity was ascribed to the phaZ gene firstly in Pseudomonas putida GPo1 [26] and later in P. putida U only by using mutagenesis/complementation experimental approaches [29, 30]
In Vivo Functionality of PhaZ from P. putida KT2442 by Using P. putida U (PhaZϪ) as Host—P. putida KT2442 is a model strain in environmental biotechnology characterized by a wide metabolic and physiologic versatility [32, 48] that is able to produce mcl-PHA from a broad carbon substrate range [49]
Summary
Materials—n-Phenylalkanoic acids and n-alkanoic acids were supplied by Lancaster Synthesis or by Sigma. [1-14C]Octanoic acid (50 mCi/mmol) was from Americans Radiolabeled Chemicals. Materials—n-Phenylalkanoic acids and n-alkanoic acids were supplied by Lancaster Synthesis or by Sigma. [1-14C]Octanoic acid (50 mCi/mmol) was from Americans Radiolabeled Chemicals. All other products were of analytical quality or high-performance liquid chromatography grade. P. putida KT2442 is a derivative strain of the parental strain KT2440 whose complete genome nucleotide sequence of the genome is accessible in the data bank. Escherichia coli and P. putida strains were grown in Luria-Bertani (LB) medium [34] at 37 °C and 30 °C, respectively. Host for E. coli plasmids Host for pQE plasmids Host for pBBR1MCS5-derived plasmids. Apr, cloning plasmid Gmr, broad range cloning plasmid Apr, T5 promoter, lac operator Kmr, LacI pUC18 derivative containing phaZ gene from P. putida KT2442. AAGAATTCTCTAGAGGGTATTAATAATGCCGCAACCCTATATTTTCAG CAGATATCAAGCTTGGCCGCAGCTGTTTCA CCCCAAGCTTAACCAAGAGTCACGTGCATGCC CGCGGATCCTCAGGCCGCAGCTGTTTCA CGGGATCCCGCAACCCTATATTTTCAGGAC a Engineered endonuclease sites on the oligonucleotides used for the cloning are shown underlined
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
