Abstract

Human nucleic acid-binding protein 1 and 2 (hNABP1 and hNABP2, also known as hSSB2 and hSSB1 respectively) form two separate and independent complexes with two identical proteins, integrator complex subunit 3 (INTS3) and C9ORF80. We and other groups have demonstrated that hNABP1 and 2 are single-stranded (ss) DNA- and RNA-binding proteins, and function in DNA repair; however, the function of INTS3 and C9OFR80 remains elusive. In the present study, we purified recombinant proteins INTS3 and C9ORF80 to near homogeneity. Both proteins exist as a monomer in solution; however, C9ORF80 exhibits anomalous behavior on SDS–PAGE and gel filtration because of 48% random coil present in the protein. Using electrophoretic mobility shift assay (EMSA), INTS3 displays higher affinity toward ssRNA than ssDNA, and C9ORF80 binds ssDNA but not ssRNA. Neither of them binds dsDNA, dsRNA, or RNA : DNA hybrid. INTS3 requires minimum of 30 nucleotides, whereas C9OFR80 requires 20 nucleotides for its binding, which increased with the increasing length of ssDNA. Interestingly, our GST pulldown results suggest that the N-terminus of INTS3 is involved in protein–protein interaction, while EMSA implies that the C-terminus is required for nucleic acid binding. Furthermore, we purified the INTS3–hNABP1/2–C9ORF80 heterotrimeric complex. It exhibits weaker binding compared with the individual hNABP1/2; interestingly, the hNABP1 complex prefers ssDNA, whereas hNABP2 complex prefers ssRNA. Using reconstituted heterotrimeric complex from individual proteins, EMSA demonstrates that INTS3, but not C9ORF80, affects the nucleic acid-binding ability of hNABP1 and hNABP2, indicating that INTS3 might regulate hNABP1/2's biological function, while the role of C9ORF80 remains unknown.

Highlights

  • GCATCTCGAGATCAGTCACTGTCAGAGCCCAC TG GCATCTCGAGGGAAACTGGCTCCTCAATTTGCATCTCGAGGTCACTGTCAGAGCCC TGCAGGATCCATGGAGATGGACAACCATAT (dT) n=10, 20, 30, 60 or 90.

  • Used in this study Forward primer to PCR amplify C9ORF80 gene Reverse primer to PCR amplify C9ORF80 gene Forward primer to PCR amplify INTS3 gene to clone in pGEX-6P-1 vector Reverse primer to PCR amplify INTS3 gene to clone in pGEX-6P-1 vector Reverse primer to PCR amplify the Nterminus of INTS3 gene Forward primer to PCR amplify Cterminus of INTS3 gene to clone in pET28a vector Reverse primer to PCR amplify C-terminus of INTS3 gene to clone in pET28a vector Forward primer to PCR amplify Cterminus of INTS3 gene to clone in pGEX6P-1 vector ssDNA ssRNA Random sequence ssRNA; form dsRNA with RNA 30-mer comp Random sequence ssDNA; form DNA:RNA hybrid with RNA 30-mer comp Random sequence ssDNA.

  • Complementary strand to RNA 30-mer; form dsRNA with RNA 30-mer; form RNA:DNA hybrid with DNA 30-mer

Read more

Summary

GCATCTCGAGATCAGTCACTGTCAGAGCCCAC TG GCATCTCGAGGGAAACTGGCTCCTCAATTT

GCATCTCGAGGTCACTGTCAGAGCCC TGCAGGATCCATGGAGATGGACAACCATAT (dT) n=10, 20, 30, 60 or 90. Used in this study Forward primer to PCR amplify C9ORF80 gene Reverse primer to PCR amplify C9ORF80 gene Forward primer to PCR amplify INTS3 gene to clone in pGEX-6P-1 vector Reverse primer to PCR amplify INTS3 gene to clone in pGEX-6P-1 vector Reverse primer to PCR amplify the Nterminus of INTS3 gene Forward primer to PCR amplify Cterminus of INTS3 gene to clone in pET28a vector Reverse primer to PCR amplify C-terminus of INTS3 gene to clone in pET28a vector Forward primer to PCR amplify Cterminus of INTS3 gene to clone in pGEX6P-1 vector ssDNA ssRNA Random sequence ssRNA; form dsRNA with RNA 30-mer comp Random sequence ssDNA; form DNA:RNA hybrid with RNA 30-mer comp Random sequence ssDNA. Complementary strand to RNA 30-mer; form dsRNA with RNA 30-mer; form RNA:DNA hybrid with DNA 30-mer

NATQPPNAEEESGSSSASEEEDTKPKPTK NNSLPR QYLSTPDSQSLR qYLSTPDSQSLR
Random mer ssRNA
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call