Autoimmune Regulator (AIRE) Is Expressed in Spermatogenic Cells, and It Altered the Expression of Several Nucleic-Acid-Binding and Cytoskeletal Proteins in Germ Cell 1 Spermatogonial (GC1-spg) Cells

Karthika Radhakrishnan,Kongattu P Bhagya,Anil Tr Kumar,Anandavalli N Devi,Jeeva Sengottaiyan,Pradeep G Kumar

doi:10.1074/mcp.m115.052951

Karthika Radhakrishnan, Kongattu P Bhagya + Show 4 more

Open Access

https://doi.org/10.1074/mcp.m115.052951

Copy DOI

Abstract

Autoimmune regulator (AIRE) is a gene associated with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). AIRE is expressed heavily in the thymic epithelial cells and is involved in maintaining self-tolerance through regulating the expression of tissue-specific antigens. The testes are the most predominant extrathymic location where a heavy expression of AIRE is reported. Homozygous Aire-deficient male mice were infertile, possibly due to impaired spermatogenesis, deregulated germ cell apoptosis, or autoimmunity. We report that AIRE is expressed in the testes of neonatal, adolescent, and adult mice. AIRE expression was detected in glial cell derived neurotrophic factor receptor alpha (GFRα)(+) (spermatogonia), GFRα(-)/synaptonemal complex protein (SCP3)(+) (meiotic), and GFRα(-)/Phosphoglycerate kinase 2 (PGK2)(+) (postmeiotic) germ cells in mouse testes. GC1-spg, a germ-cell-derived cell line, did not express AIRE. Retinoic acid induced AIRE expression in GC1-spg cells. Ectopic expression of AIRE in GC1-spg cells using label-free LC-MS/MS identified a total of 371 proteins that were differentially expressed. 100 proteins were up-regulated, and 271 proteins were down-regulated. Data are available via ProteomeXchange with identifier PXD002511. Functional analysis of the differentially expressed proteins showed increased levels of various nucleic-acid-binding proteins and transcription factors and a decreased level of various cytoskeletal and structural proteins in the AIRE overexpressing cells as compared with the empty vector-transfected controls. The transcripts of a select set of the up-regulated proteins were also elevated. However, there was no corresponding decrease in the mRNA levels of the down-regulated set of proteins. Molecular function network analysis indicated that AIRE influenced gene expression in GC1-spg cells by acting at multiple levels, including transcription, translation, RNA processing, protein transport, protein localization, and protein degradation, thus setting the foundation in understanding the functional role of AIRE in germ cell biology.

Highlights

Using GC1-spg cells as an efficient AIREdeficient model, we evaluated the impact of transient Autoimmune regulator (AIRE) expression on the cellular proteome of these cells and the possible gain of function that could be attributed to AIRE
Aire gene was amplified from cDNA using primers 1306F and 1456R, which yielded a single band of 150 bp length (Fig. 1A)
We could confirm the expression of Aire in spermatogonia, primary spermatocytes, and postmeiotic germ cells

Summary

EXPERIMENTAL PROCEDURES

Reagents—Lipofectamine 2000, DMEM, DMEMF12, OptiMEM, FBS, antibiotic–antimycotic mixture L-glutamine, 1X MEM vitamins, nonessential amino acids StemPro SFM base (Invitrogen, Green Island, CA); EcoR1, Streptomyces albus 1 (Sal1), calf intestinal phosphatase (CIP), New England Biolab (NEB) buffer 3, EcoR1 Buffer, DNA ligase, and ligase buffer (New England Biolabs, Ipswich, MA); Nucleobond Xtra midi Plus EF kit (Macherey Nagel, Duren, Germany); gel extraction kit (GE Healthcare, Buckinghamshire, UK); 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), MgCl2, KCl, NaCl, 2,2Ј,2Љ,2ٞ-(ethane-1,2-diyldinitrilo) tetra acetic acid (EDTA), glycerol, SUPERSCRIPT® VILOTM cDNA synthesis kit (Invitrogen, Waltham, MA); SYBR green master mix plates, ABI PRISM® 384-well optical reaction (Applied Bio systems, Waltham, MA), QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany); protease inhibitor mixture, bovine. Fragments of seminiferous tubules were flushed in and out several times through a micropipette tip to ensure maximal dispersal of cells This was followed by 15 min incubation room temperature to allow sedimentation of large fragments. Quantitative Real-Time PCR—Quantitative real-time PCR was performed on the cDNA samples prepared from EGFPN1-AIRE-transfected GC1 cells (test) as well as empty-vector-transfected GC1 cells (control) using SYBR green master mix (Applied Bio Systems) in ABI PRISM® 384-well optical reaction plates. RT-PCR—Reverse transcriptase PCR was performed on the cDNA samples prepared from EGFPN1-AIRE-transfected GC1 cells (test) and empty-vector-transfected GC1 cells (control) using full-length Aire specific primers: 5Ј GAATTCATGGCGACGGACGCGGCGCTA as forward primer and 5Ј GTCGACGAGGGGAAGGGGGCCGCCGG as reverse primer. EGFPN1-AIRE-transfected GC1 cells (test) as well as empty-vector-transfected GC1 cells (control) were lysed in RIPA buffer (150 mM NaCl, 1.0% octyl phenoxy polyethoxy ethanol (IGEPAL), 0.5% sodium deoxycholate, 0.1% SDS, and 50 mM Tris, pH 8.0) containing protease inhibitor mixture (Sigma Aldrich). The data were trimmed to minimum connected network and Function explorer was run using all nodes in the network as input and Gene Ontology (GO) term molecular function (MF)

Aire Transcripts and Protein Are Present in Mouse Testis of

DISCUSSION

Gene name