Abstract

BackgroundMutations of the autoimmune regulator gene (AIRE), located on chromosome 21q22.3, are recognized as the cause of a rare monogenic organ-specific autoimmune disorder called autoimmune polyglandular syndrome type 1 (APS-1). Three major components of this syndrome include chronic mucocutaneous candidiasis (CMC), hypoparathyroidism, and adrenocortical failure.Case presentationWe report a 19-year-old girl, who was born in an Iranian Muslim family with a clinical diagnosis of APS-1. To identify the causative mutation, a direct sequencing of the entire AIRE gene sequence was performed by Sanger sequencing method.Three distinct variants were discovered, including c.1095 + 2 T > A, c.1197 T > C (rs1800521) and c.1578 T > C (rs1133779), in intron 9, exons 10 and 14 of the AIRE gene, respectively.ConclusionsTo the best of our knowledge, this is the first report of an Iranian Muslim APS-1 patient with combination of these variations. In addition, the effect of c.1095 + 2 T > A mutation on AIRE mRNA expression was reported for the first time. This study expands the diversity of variants that could cause APS-1. More genetic studies are required to determine the exact frequency of these variants and their diagnostic significance.

Highlights

  • Mutations of the autoimmune regulator gene (AIRE), located on chromosome 21q22.3, are recognized as the cause of a rare monogenic organ-specific autoimmune disorder called autoimmune polyglandular syndrome type 1 (APS-1)

  • To the best of our knowledge, this is the first report of an Iranian Muslim APS-1 patient with combination of these variations

  • The effect of c.1095 + 2 T > A mutation on AIRE messenger Ribonucleic Acids (RNAs) (mRNAs) expression was reported for the first time

Read more

Summary

Conclusions

To the best of our knowledge, this is the first report of an Iranian Muslim APS-1 patient with combination of these variations. The effect of c.1095 + 2 T > A mutation on AIRE mRNA expression was reported for the first time. This study expands the diversity of variants that could cause APS-1. More genetic studies are required to determine the exact frequency of these variants and their diagnostic significance

Background
F: ATGGCCATGATTCTGTGGCTG
Findings
F: CCTGGCGTCGTGATTAGTGAT
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.