Abstract
BackgroundConcerns regarding the safety of inactivated foot-and-mouth disease (FMD) vaccine have been raised since it is produced from cultured live FMD virus (FMDV). To overcome this issue, recombinant protein has been studied as an alternative vaccine.Results and conclusionWe designed a chimerical multi-epitope recombinant protein (5BT), which is comprised of tandem repeats of five B cell epitopes (residue of VP1 136–162) derived from different FMDV variants and one T-cell epitope (residue of 3A 21–35). To increase solubility and stability of 5BT, it was conjugated with BmpB, the membrane protein B of Brachyspira hyodysenteriae (B5BT). Our results indicated that 5BT was susceptible to degradation by host protease and produced with substantial fraction of inclusion body. The stability and solubility of 5BT was greatly increased by conjugating to BmpB. FMDV specific antibodies were observed in the serum of mice immunized with 5BT and B5BT comparable to inactivated FMD vaccine. Sera from 5BT and B5BT groups also exhibited high epitope-specific antibody titers in peptide specific ELISA, indicating that all five epitopes are exposed to the B cell receptor for the antibody reaction. Thus the multi-epitope recombinant protein designed in this study may be a potential candidate as an alternative vaccine against FMDV epidemic variants.
Highlights
Concerns regarding the safety of inactivated foot-and-mouth disease (FMD) vaccine have been raised since it is produced from cultured live FMD virus (FMDV)
We introduced T-cell epitope in one of FMDV non-structure proteins (NSPs) in C-terminus of the protein to enhance the immune response of the subunit vaccine
To minimize interference between adjacent epitopes, each epitope was separated by two glycines, and T-cell epitope was separated from five B-cell epitopes by two glycines and one glutamate. 5BT gene was cut out by Xho I and ligated with pET21aBmpB precut with Xho I [21] resulting in pET21a-BmpB5BT (B5BT). 5BT gene was amplified by PCR from the pIDTSMART-AMP using an upstream primer engineered to introduce an Nde I site (5′- AATTTTACCATATGGGTGGGAGTTATGGCAA ATCCCC-3′) and a downstream one with a Xho I site (5′-GATCCGCTCGAGTTTGATGGACGG -3′)
Summary
Concerns regarding the safety of inactivated foot-and-mouth disease (FMD) vaccine have been raised since it is produced from cultured live FMD virus (FMDV). To overcome this issue, recombinant protein has been stud‐ ied as an alternative vaccine. If the NSPs are not completely removed in the process, it would cause a serious biosafety concern, which would hinder efforts to employ serology to distinguish between infected and vaccinated animals (DIVA) [7, 8] This fact leads to classifying all countries as FMD free with or without the use of vaccination by OIE, world organization for animal health. Most of countries have introduced a policy of the stamping out of FMD infected animal to remain FMD free rather than employing vaccination [2]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
