Abstract
Recent studies revealed that some passenger strands of miRNAs acted as anti-tumor or oncogenic miRNAs in cancer cells. In this study, we focused on miR-455-5p (the passenger strand) and miR-455-3p (the guide strand) based on microRNA (miRNA) expression signatures of cancer cells. Both miR-455-5p and miR-455-3p were downregulated in renal cell carcinoma (RCC) tissues and low expression of these miRNAs was significantly associated with poor prognosis. Cancer cell proliferation, migration and invasive abilities were significantly inhibited by ectopic expression of miR-455-5p and miR-455-3p. To identify their oncogenic targets, we applied a combination of genome-wide gene expression and in silico miRNA database analyses. We focused on spindle and kinetochore-associated proteins, SKA1 and SKA3 and demonstrated direct regulation of SKA1 by miR-455-5p and SKA3 by miR-455-3p in RCC cells. Our present data demonstrated overexpression of SKA3 in RCC clinical specimens. Moreover, the study showed that the miR-455-3p/SKA3 axis contributed to cancer cell aggressiveness. Analytic strategies based on anti-tumor miRNAs, including passenger strands of miRNAs, are effective approaches for the elucidation of the molecular pathogenesis of RCC.
Highlights
Renal cell carcinoma (RCC) is the most common kidney-associated neoplasm
The public miRNA database revealed that miR-455 is located on chromosome 9q32 and the mature sequence of miR-455-5p was 5’ – uaugugccuuuggacuacaucg – 3’ and that of miR455-3p was 5’ - gcaguccaugggcauauacac – 3’
We focused on spindle and kinetochore-associated complex subunits 1 and 3 (SKA1 and SKA3) because we recently reported that regulation of spindle and kinetochore associated protein 1 (SKA1) by anti-tumor miR-10a-5p was involved in renal cell carcinoma (RCC) pathogenesis
Summary
Renal cell carcinoma (RCC) is the most common kidney-associated neoplasm. Clear cell RCC is the most frequent type, accounting for 70-80% of cases [1]. RCC constitutes 2-3% of human cancers, and the proportion is increasing. More than 350,000 people were diagnosed with RCC and 140,000 people died in 2013 [2]. Treatment for localized RCC is mainly surgical resection, which has a good prognosis, the prognosis for metastatic RCC at diagnosis remains poor. Treatments for RCC have grown more sophisticated
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
