Abstract
Hypertension is a serious health problem in Western society, in particular for the African-American population. Although previous studies have suggested that the angiotensinogen (AGT) gene locus is involved in human essential hypertension, the molecular mechanisms involved in hypertension in African-Americans remain unknown. We show that an A/G polymorphism at -217 in the promoter of the AGT gene plays a significant role in hypertension in African-Americans. The frequency of the -217A allele was increased significantly in African-American hypertensive subjects compared with normotensive controls. We also show that the nucleotide sequence of this region of the AGT gene promoter bound strongly to CAAT/enhancer-binding protein (C/EBP) family transcription factors when nucleoside A was present at -217. In addition, we show that reporter constructs containing the human AGT gene promoter with nucleoside A at -217 had increased basal transcriptional activity upon transient transfection in HepG2 cells compared with reporter constructs with nucleoside G at -217. Finally, we show that interleukin-6 treatment in the presence or absence of overexpressed C/EBPbeta increased the promoter activities of reporter constructs containing nucleoside A at -217 compared with reporter constructs containing nucleoside G at -217. Because the AGT gene is expressed primarily in liver and adipose tissue, and C/EBP family transcription factors play an important role in gene expression in these tissues, we propose that increased transcriptional activity of the -217A allele of the human AGT gene is associated with hypertension in African-Americans.
Highlights
Hypertension is a serious risk factor for myocardial infarction, heart failure, vascular disease, stroke, and renal failure [1,2,3]
Frequency of the Ϫ217A Allele of the AGT Gene Is Increased in African-American Hypertensive Patients—To understand the role of the A/G polymorphism at Ϫ217 in the promoter of the AGT gene in hypertension, we have analyzed genomic DNAs from 186 hypertensive and 156 normotensive AfricanAmerican subjects
We have presented evidence that an A/G polymorphism at Ϫ217 may be involved in hypertension in the African-American population
Summary
Plasmid Construction—The reporter construct pHAGT1.3luc was constructed by PCR amplification of the human AGT gene [21, 22] using TATGCTAGTCGAGTGAGTCCCTATCTATAGTGAACA as the forward primer and CAAGTACCAGTAAGTGAGTCTGAGTGGGGCCCCGCTTA as the reverse primer. The amplified fragment contained nucleotides Ϫ303 to ϩ70 and was subcloned in the pGL3-basic vector These reporter constructs had nucleoside A at Ϫ6 and Ϫ217. The amplification product (233 bp) contained nucleotides Ϫ314 to Ϫ82 of the human AGT gene promoter, including the A/G polymorphic site at Ϫ217 These amplified fragments were treated with either AluI or HpaII to identify the A/G polymorphic site at Ϫ217. Statistical Analysis—The GraphPAD statistical software package (GraphPAD Version 3.00 for Windows, GraphPAD Software, San Diego, CA) was used for analysis of the clinical characteristics, differences in allele frequency between case and control subjects, and comparison of promoter activities of different reporter constructs in transient transfection assays. Unpaired t tests were performed to compare relative luciferase activities of reporter constructs containing nucleoside A or G at position Ϫ217 of the AGT gene promoter in transfection experiments. All experiments were conducted in sextuplicate in four independent transfection experiments as described recently [26]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
