Abstract
Mammalian Kiaa1211 and Kiaa1211-like are a homologous pair of uncharacterized, highly conserved genes cloned from fetal and adult brain cDNA libraries. Herein we map the in utero spatiotemporal expression of mKiaa1211 and mKiaa1211L mRNA and their expression patterns in postnatal testis, skin, gastrointestinal, and adipose progenitor tissues. Significantly, mKiaa1211 is present throughout the early stages of mouse heart development, particularly in the second heart field (SHF) lineage as it differentiates from mesenchymal cells into cardiomyocytes. We also show that mKiaa1211 is expressed within several early neuronal tissues destined to give rise to central, peripheral, and sympathetic nervous system structures. Expression profiling revealed that the paralog mKiaa1211L is not expressed during the normal developmental process and that mKiaa1211 expression was noticeably absent from most adult terminally differentiated tissues. Finally, we confirm that a previously uncharacterized CRISPR/CAS-generated mKiaa1211 mouse mutant allele is hypomorphic.
Highlights
Even in relatively well-studied model organisms, the majority of coding and both small and long non-coding RNAs have yet to be experimentally characterized [1,2,3]
The following sets of primers were used: 5 CCACCCATGGCCTTCACATA and 3 GCATTCAGGAGAGTGAACACCA; 5 AGGAAAAAGCTGGCTCCCAA and 3 GTACTGGTAAGACGGGGCAC. mKiaa1211L (MGI:1919347) primers were designed to amplify nucleotides 3624–3796 bp of M. musculus mRNA using these primers: 5 GTCCCATCAGAACTTGGCTCA and 3 CCAGCAGCCTGCCAATCTAT. qPCR was performed in technical triplicate for each sample and qPCR reactions were carried out using SYBR GreenER (Invitrogen, Carlsbad, CA, USA)
As Mouse ENCODE transcriptome data indicate that the adult testis expresses the highest levels, we examined which cell types express mKiaa1211 in order to help understand its potential function. mKiaa1211 was very robustly expressed in adult testis in a restricted pattern within the mitotic spermatogonia and meiotic primary spermatocytes Type A and B, whereas interphase spermatids and mature sperm did not express mKiaa1211 (Figure 4A,B)
Summary
Even in relatively well-studied model organisms, the majority of coding and both small and long non-coding RNAs have yet to be experimentally characterized [1,2,3]. Establishing a gene’s spatiotemporal expression pattern is an important first step in understanding or predicting the potential physiological and functional role of genes/proteins and how they may interact to form the complex networks that underlie organ formation, function, and homeostasis [4,5]. This is important in developmental biology, since dynamic spatial and temporal gene expression is a fundamental aspect of development [5,6], allied to the rapid and lineage-restricted remodeling events occurring during each morphological stage. We provide detailed expression data at cellular resolution for both uncharacterized genes during mouse development and within specific in utero and postnatal progenitor tissues that will help guide future gene molecular, physiological, and functional classification studies. mKiaa1211 will serve as a useful marker of the SHF during heart morphogenesis
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
