Abstract
The herpes simplex virus trans-activator Vmw65 interacts with the cellular factors Oct-1 and VCAF-1 to generate a multicomponent DNA binding complex that specifically recognizes conserved enhancer elements found upstream of the viral immediate-early genes, resulting in potent stimulation of their transcription. We have identified a HeLa cell factor, distinct from Oct-1 or VCAF-1, which significantly enhances the stability or formation of Vmw65-dependent complexes, as judged by mobility shift analysis using either nuclear extracts or bacterially expressed Oct-1 and Vmw65. This factor, designated SF (stimulatory factor), was partially purified from HeLa cell postnuclear extracts and has an apparent molecular weight of 1500-3000, based on ultrafiltration and size-exclusion chromatography. SF was shown to be resistant to inactivation by heat treatment, protease, nuclease, and phospholipase digestions, and extraction with organic solvents. Pretreatment of SF with beta-glucuronidase did not affect its ability to stimulate Vmw65-dependent complex formation but did reduce the electrophoretic mobility of the resulting complex. These data indicate that SF is probably a component of the Vmw65-induced complex and may be composed, at least partially, of carbohydrate.
Highlights
The herpes simplex virus trans-activator Vmw65 interacts with the cellular factors Oct-1 and VCAF-1 to generate a multicomponent DNA binding complex that recognizes conserved enhancer elements foundupstreamof the viral immediate-early genes, resulting in potent stimulation of their transcription
Oct-1 binds to the well characterized octamer element (AGTCAAAT) whichis found in alarge number of cellular promoters, and binds directly to TAATGARAT elements or extended variants thereof [21, 22], where it directs the stepwise assembly of a multicomponent complex containing Oct-1, Vmw65, and VCAF-1 [9, 17, 19, 23]
Vmw65 has a weak DNA binding activity specific tothe GARAT portion of TAATGARAT elements which can be augmented by a denaturation/renaturation step [9]
Summary
GATCCCGTGCATGCTAATGATATTCTTT (annealed to its com- procedure [34] as follows: 1 ml of the excluded fraction was mixed plementarystrand) which correspondstothepromoterproximal with 3.75 ml of a 2:l mixture of methanol/chloroform after which. Ex- 50 pl of the filtratewas incubated with trypsin(50 pg/ml), proteinase pressedproteinA/Oct-1 fusion protein waspurified from E. coli K (50 pg/ml), RNaseA (10 pg/ml), DNase I (10 pg/ml), or phosphotransformed with pRIT-POU which expresses amino acids 271-441 (encompassing the POU-homeodomain)of Oct-1 fused to protein A. This plasmid was constructedfrompBSOct-1(31) by ligating a BamHI linker (5"CCGGATCCGG) to the HincII site upstream of lipase A, (100 Fg/ml) for 2 ha t 37 "C in appropriatebuffers according to the manufacturers' instructions. Fractions containing VCAF-1 activity (eluting at 180-200 mM KC1) were monitored by mobility shift assay using
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
