Abstract
Nervous necrosis virus (NNV), Genus Betanodavirus, is the causative agent of viral encephalopathy and retinopathy (VER), a neuropathological disease that causes fish mortalities worldwide. The NNV genome is composed of two single-stranded RNA molecules, RNA1 and RNA2, encoding the RNA polymerase and the coat protein, respectively. Betanodaviruses are classified into four genotypes: red-spotted grouper nervous necrosis virus (RGNNV), striped jack nervous necrosis virus (SJNNV), barfin flounder nervous necrosis virus (BFNNV) and tiger puffer nervous necrosis virus (TPNNV). In Southern Europe the presence of RGNNV, SJNNV and their natural reassortants (in both RNA1/RNA2 forms: RGNNV/SJNNV and SJNNV/RGNNV) has been reported. Pathology caused by these genotypes is closely linked to water temperature and the RNA1 segment encoding amino acids 1–445 has been postulated to regulate viral adaptation to temperature. Reassortants isolated from sole (RGNNV/SJNNV) show 6 substitutions in this region when compared with the RGNNV genotype (positions 41, 48, 218, 223, 238 and 289). We have demonstrated that change of these positions to those present in the RGNNV genotype cause low and delayed replication in vitro when compared with that of the wild type strain at 25 and 30 °C. The experimental infections confirmed the impact of the mutations on viral replication because at 25 °C the viral load and the mortality were significantly lower in fish infected with the mutant than in those challenged with the non-mutated virus. It was not possible to challenge fish at 30 °C because of the scarce tolerance of sole to this temperature.
Highlights
Viral virulence is determined by multiple factors, including host cell recognition, viral replication efficiency and/ or ability to deal with the host’s immune system [1]
Recovery of the mutant strain r1_445 Site-directed mutagenesis was used to perform 6 nucleotide changes in the RNA1 genome of r160 which removed the differences observed between the wt160 sequence and the sequence of SGWak97 (GenBank accession number NC_008040)
At 6 and 8 dpi, cells inoculated with striped jack nervous necrosis virus (SJNNV) and wt160 strains and those infected with r160 strain, respectively, showed similar characteristics
Summary
Viral virulence is determined by multiple factors, including host cell recognition, viral replication efficiency and/ or ability to deal with the host’s immune system [1]. The interaction host-virus-environment can have relevant effects on virus production, and on virulence [2]. Temperature has a crucial effect on viruses hosted by fish because these are ectothermic animals. Nervous necrosis viruses (NNV), members of the genus Betanodavirus, are the causative agents of a serious neuropathological condition, affecting fish worldwide, Souto et al Vet Res (2019) 50:50. Oligonucleotide sequence (5′ to 3′)a nt substitutionb. AGGATTATCGCCAACGCGTCATCGCTGAGAAGAAACGCGTCATCGCTGAGAAGAAACAAATTCTCCGTGATGC CCCGACCTCGAGGTTTCTGGGCGAATCGAGGTTTCTGGGCGAATCTGATGCAGATCCTGGTCACCGCGATCTGTAGTTTTCTTTACACCAAGC CAAGATCAGTGAGTATGGTGCTGAGTTGGAGTATATGCG a Nucleotides used for mutagenesis are underlined. A-199 → G G-220 → A C-730 → T T-745 → A A-791 → T A-943 → G aa substitution
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
