Amino Acid Proximities in Two Sup35 Prion Strains Revealed by Chemical Cross-linking

Shenq-Huey Wong,Chih-Yen King

doi:10.1074/jbc.m115.676379

Abstract

Strains of the yeast prion [PSI] are different folding patterns of the same Sup35 protein, which stacks up periodically to form a prion fiber. Chemical cross-linking is employed here to probe different fiber structures assembled with a mutant Sup35 fragment. The photo-reactive cross-linker, p-benzoyl-l-phenylalanine (pBpa), was biosynthetically incorporated into bacterially prepared recombinant Sup(1-61)-GFP, containing the first 61 residues of Sup35, followed by the green fluorescent protein. Four methionine substitutions and two alanine substitutions were introduced at fixed positions in Sup(1-61) to allow cyanogen bromide cleavage to facilitate subsequent mass spectrometry analysis. Amyloid fibers of pBpa and Met/Ala-substituted Sup(1-61)-GFP were nucleated from purified yeast prion particles of two different strains, namely VK and VL, and shown to faithfully transmit specific strain characteristics to yeast expressing the wild type Sup35 protein. Intra- and intermolecular cross-linking were distinguished by tandem mass spectrometry analysis on fibers seeded from solutions containing equal amounts of (14)N- and (15)N-labeled protein. Fibers propagating the VL strain type exhibited intra- and intermolecular cross-linking between amino acid residues 3 and 28, as well as intra- and intermolecular linking between 32 and 55. Inter- and intramolecular cross-linking between residues 32 and 55 were detected in fibers propagating the VK strain type. Adjacencies of amino acid residues in space revealed by cross-linking were used to constrain possible chain folds of different [PSI] strains.

Highlights

Different but currently uncharacterized chain folding patterns of the Sup[35] protein determine the prion strain type
Plasmids Construction—The Escherichia coli T7 expression plasmid pSup(1– 61)-GFP-Strep(II)-His[6] was constructed by replacing the 1-kb NdeI/NotI fragment of pHis-N1-GFPStrep(II) (3) with a PCR fragment amplified by two primers (5Јgtacatatgtcggattcaaaccaaggcaac and 5Ј-gtagcggccgcttactaatggtggtgatgatgatgtttttcgaactgcgggtggc; the NdeI and NotI sites are underlined) using pHis-N1-GFP-Strep(II) as the template. p-Benzoyl-L-phenylalanine substitutions (Asp[3], Arg[28], Tyr[32], Tyr[52], and Tyr[55] codons substituted with a TAG amber codon), four fixed methionine substitutions (Tyr[13], Tyr[29], Tyr[35], and Tyr[46] codons substituted with ATG), and S2A and S4A mutations were generated by QuikChange II site-directed mutagenesis kit (Agilent Stratagene)
Infectious Fibers—Experiments were performed with fibers derived from mutant Sup(1– 61)-GFPs, containing the first 61 amino acid residues of Sup[35] followed by the GFP, which enhanced solubility and facilitated experimental observation

Summary

Background

Different but currently uncharacterized chain folding patterns of the Sup[35] protein determine the prion strain type. Adjacencies of amino acid residues in space revealed by cross-linking were used to constrain possible chain folds of different [PSI] strains. Chin et al (15) extended the amino acid repertoire for cellular protein synthesis by engineered an orthogonal tRNA/aminoacyl-tRNA synthetase pair that transferred pBpa at a uniquely engineered amber codon Employing this technology, pBpa was biosynthetically incorporated into recombinant proteins, which were converted into strain-specific prion conformations by nucleation. Strain-specific chain folding patterns of Sup[35] monomers can be further constrained by tertiary adjacencies of amino acid residues, derivable with chemical cross-linking experiments. Two issues are relevant in selecting a proper cross-linking reagent: (i) the sequence of Sup[35] prion domain is of low complexity, composed mainly of glutamine, tyrosine, asparagine, and glycine residues This limits the choice of a cross-linker that reacts with specific functional groups of amino acid side chains. Upon UV irradiation at a wavelength between 350 and 360 nm, the photo-generated triplet state of the benzophenone group abstracts a hydrogen atom from geometrically accessible carbon-hydrogen bond of the polypeptide backbone and side chain methylene groups and

Experimental Procedures

Results

Discussion