Abstract
ATP-sensitive potassium channels (KATP) are implicated in a diverse array of physiological functions. Previous work has shown that alternative usage of exons 14, 39, and 40 of the muscle-specific KATP channel regulatory subunit, sur2, occurs in tissue-specific patterns. Here, we show that exon 17 of the first nucleotide binding fold of sur2 is also alternatively spliced. RNase protection demonstrates that SUR2(Delta17) predominates in skeletal muscle and gut and is also expressed in bladder, fat, heart, lung, liver, and kidney. Polymerase chain reaction and restriction digest analysis of sur2 cDNA demonstrate the existence of at least five sur2 splice variants as follows: SUR2(39), SUR2(40), SUR2(Delta17/39), SUR2(Delta17/40), and SUR2(Delta14/39). Electrophysiological recordings of excised, inside-out patches from COS cells cotransfected with Kir6.2 and the sur2 variants demonstrated that exon 17 splicing alters KATP sensitivity to ATP block by 2-fold from approximately 40 to approximately 90 microM for exon 17 and Delta17, respectively. Single channel kinetic analysis of SUR2(39) and SUR2(Delta17/39) demonstrated that both exhibited characteristic KATP kinetics but that SUR2(Delta17/39) exhibited longer mean burst durations and shorter mean interburst dwell times. In sum, alternative splicing of sur2 enhances the observed diversity of KATP and may contribute to tissue-specific modulation of ATP sensitivity.
Highlights
ATP-sensitive potassium channels (KATP),1 first described in cardiac myocytes [1, 2], are weak inwardly rectifying Kϩ channels, which are inhibited by intracellular ATP and activated by Mg-ADP [3, 4]
Sur2 Variants and Function volved in alternative splicing to clarify the identified sur2 variants, as well as future yet to be described variants resulting from alternative splicing
The results demonstrated that exon 14 containing sur2 variants were present with both exon 39 and 40 carboxyl-terminal domain (CTD) tails, but the SUR2(⌬14) variant, which was expressed sur2 Variants and Function in heart alone, only existed with the exon 39 CTD
Summary
Total RNA was isolated from whole organ mouse tissues by TRIzol extraction (Life Technologies, Inc.). Exon 14/Exon 39 – 40 Relationship—Primers (forward, 5Ј-GAA GCTGGCGGAGGCTCAGAAGAG-3Ј; reverse, 5Ј- GATCGGGCCCACTTTTCGAG TGTGGACAGA TCGTA-3) were designed to reside 500 bp 5Ј to exon 14 and 3Ј of exon 40 These primers were used to amplify cDNA using Klentaq polymerase under the following conditions: 36 cycles of 96 °C ϫ 30 s melting, 68 °C ϫ 3 min annealing/extension. The digested products were resolved on 0.8% SeaKem agarose gels (FMC), and the corresponding sur fragments with and without exon 14 were gel-purified using Qiaex II gel purification (Qiagen). Sequence integrity and orientation was confirmed by dye termination sequencing (Applied Biosystems, Perkin-Elmer) This template was used to generate labeled antisense RNA transcripts by in vitro transcription in the presence of 800 Ci/mmol ␣-[32P]CTP (Amersham Pharmacia Biotech) and T3 RNA polymerase (Promega). The gel was autoradiographically exposed to Biomax MR film (Kodak) overnight at Ϫ80 °C or was exposed to a phosphorimaging cassette (Molecular Dynamics) for 3 h at room temperature for quantitation
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
