Age-Related Macular Degeneration Genetics

Abstract

An understanding of the pathogenesis of age-related macular degeneration (AMD), the most common cause of visual disability in elderly individuals in developed countries, is advancing rapidly, but the pathogenesis remains unclear. Age-related macular degeneration is considered primarily a multifactorial disease that is influenced by age, ethnicity, and a combination of environmental and genetic risk factors.1Haddad S. Chen C.A. Santangelo S.L. Seddon J.M. The genetics of age-related macular degeneration: a review of progress to date.Surv Ophthalmol. 2006; 51: 316-363Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar Until now, genetic studies have reported only variants of several genes that minimally affect the disease, but the last genomewide linkage studies have identified 2 single-nucleotide polymorphisms (SNPs) in 2 regions (1q32 and 10q26) that are strongly associated with AMD. The variant Tyr402His of the complement factor H (CFH) gene, a cofactor in the inactivation of the alternative complement pathway, is the first major AMD susceptibility allele2Klein R.J. Zeiss C. Chew E.Y. et al.Complement factor H polymorphism in age-related macular degeneration.Science. 2005; 308: 385-389Crossref PubMed Scopus (3476) Google Scholar that increases the risk for AMD (odds ratio [OR], 2.1–7.4). In addition, the variant Arg69Ser of LOC387715, a hypothetical protein of unknown function, is the second major AMD susceptibility allele3Kanda A. Chen W. Othman M. et al.A variant of mitochondrial protein LOC387715/ARMS2, not HTRA1, is strongly associated with age-related macular degeneration.Proc Natl Acad Sci U S A. 2007; 104: 16227-16232Crossref PubMed Scopus (360) Google Scholar (OR, 3.45–8.21). Some studies have suggested that the different forms of AMD can arise from diverse physiologic processes.4Yoshida T. Ohno-Matsui K. Ichinose S. et al.The potential role of amyloid beta in the pathogenesis of age-related macular degeneration.J Clin Invest. 2005; 115: 2793-2800Crossref PubMed Scopus (182) Google Scholar Therefore, it is important to confirm the association of both risk alleles with the different forms of AMD.We performed genotyping of Y402H and A69S in a Spanish population (120 patients with advanced wet AMD, 51 patients with early AMD [bilateral soft drusen], and 151 age-matched controls). A significant association was found between wet AMD and both risk alleles, C for Y402H and T for A69S, with ORs of 2.2 (95% confidence interval [CI], 1.5–3.2; P = 9.0×10−6) and 3.4 (95% CI, 2.3–5.0; P = 6.6×10−11), respectively. Patients with early AMD had significant differences only in the C allele (OR, 1.6; 95% CI, 1.0–2.6; P = 0.033). The distribution of genotypes showed a significantly increased risk of neovascular AMD compared with controls in homozygosity of risk alleles, with a 7.7-fold increase (95% CI, 3.0–19.7; P = 2.3×10−5) for Y402H (CC) and an 11.8-fold increase (95% CI, 4.4–31.3; P = 7.5×10−7) for A69S (TT). Meanwhile, the early AMD group had an OR of 3.9 (95% CI, 1.3–11.6) for the CC genotype (Table 1, Table 2 [all tables available at http://aaojournal.org]). The joint contribution of these 2 AMD susceptibility loci was assessed by logistic regression analysis modeling both SNPs together in wet AMD patients versus controls. Our data showed an independent association between both SNPs and wet AMD and an OR of 26.2 (95% CI, 4.9–139.7) for individuals homozygous for risk alleles at both loci (CCTT) compared with the baseline no-risk genotype (TTGG) (Table 3).Table 1Allele and Genotype Distributions of the Y402H Single-Nucleotide Polymorphism in Patients with Early Age-Related Macular Degeneration (AMD), Wet AMD, and ControlsStatus (n)TTCTCCCOR (C) (95% CI)P Value⁎Fisher exact test, which determines the presence of significant differences in C and CC frequencies between affected and control individuals.OR (CC) (95% CI)P Value⁎Fisher exact test, which determines the presence of significant differences in C and CC frequencies between affected and control individuals.Controls (151)74 (0.49)68 (0.45)9 (0.06)86 (0.28)Early AMD (51)19 (0.37)23 (0.45)9 (0.17)41 (0.40)1.6 (1.0–2.6)0.0333.9 (1.3–11.6)0.01Wet AMD (120)36 (0.30)54 (0.45)30 (0.25)114 (0.47)2.2 (1.5–3.2)9.0×10−67.7 (3.0–19.7)2.3×10−5SmokerNS†Differences in frequencies of C allele and CC genotype in smoker wet AMD versus total wet AMD.NS†Differences in frequencies of C allele and CC genotype in smoker wet AMD versus total wet AMD. Wet AMD (42)10 (0.24)19 (0.45)13 (0.31)45 (0.54)4.1 (2.0–8.2)5.2×10−57.2 (1.8–12.4)0.005 Controls (34)18 (0.53)15 (0.44)1 (0.03)17 (0.25)NonsmokerNS‡Differences in frequencies of C allele and CC genotype in nonsmoker wet AMD versus total wet AMD.NS‡Differences in frequencies of C allele and CC genotype in nonsmoker wet AMD versus total wet AMD. Wet AMD (78)26 (0.33)35 (0.45)17 (0.22)69 (0.44)1.9 (1.2–2.9)0.0034.5 (1.7–11.9)0.002 Controls (117)56 (0.48)53 (0.45)8 (0.07)69 (0.29)C = risk allele; CC = risk genotype; CI = confidence interval; NS = not significant; OR = odds ratio.Odds ratios were calculed for C and CC. Fisher exact test, which determines the presence of significant differences in C and CC frequencies between affected and control individuals.† Differences in frequencies of C allele and CC genotype in smoker wet AMD versus total wet AMD.‡ Differences in frequencies of C allele and CC genotype in nonsmoker wet AMD versus total wet AMD. Open table in a new tab Table 2Allele and Genotype Distributions of the A69S Single-Nucleotide Polymorphism in Patients with Early Age-Related Macular Degeneration (AMD), Wet AMD, and ControlsStatus (n)GGGTTTTOR (T) (95% CI)P Value⁎Fisher exact test, which determines the presence of significant differences in T and TT frequencies between affected and control individuals.OR (TT) (95% CI)P Value⁎Fisher exact test, which determines the presence of significant differences in T and TT frequencies between affected and control individuals.Controls (151)91 (0.61)51 (0.34)7 (0.05)65 (0.21)Early AMD (51)30 (0.59)18 (0.35)3 (0.06)24 (0.23)1.1 (0.8–1.7)NS1.1 (0.2–4.8)NSWet AMD (120)33 (0.27)57 (0.48)30 (0.25)117 (0.49)3.4 (2.4–5.0)6.6×10−1111.8 (4.4–31.3)7.5×10−7SmokerNS†Differences in frequencies of T allele and TT genotype in smoker wet AMD versus total wet AMD.NS†Differences in frequencies of T allele and TT genotype in smoker wet AMD versus total wet AMD. Wet AMD (42)11 (0.26)21 (0.50)10 (0.24)41 (0.49)4.3 (2.1–8.9)6.0×10−59.1 (1.6–49.4)0.01 Controls (34)20 (0.59)12 (035)2 (0.06)14 (0.20)NonsmokerNS‡Differences in frequencies of T allele and TT genotype in nonsmoker wet AMD versus total wet AMD.NS‡Differences in frequencies of T allele and TT genotype in nonsmoker wet AMD versus total wet AMD. Wet AMD (78)22 (0.28)36 (0.46)20 (0.26)76 (0.49)2.8 (1.8–4.4)1.5×10−613.4 (4.5–39.9)2.9×10−6 Controls (117)74 (0.63)38 (0.33)5 (0.04)58 (0.25)CI = confidence interval; NS = not significant; OR = odds ratio; T = risk allele; TT = risk genotype.Odds ratio were calculed for T and TT. Fisher exact test, which determines the presence of significant differences in T and TT frequencies between affected and control individuals.† Differences in frequencies of T allele and TT genotype in smoker wet AMD versus total wet AMD.‡ Differences in frequencies of T allele and TT genotype in nonsmoker wet AMD versus total wet AMD. Open table in a new tab Table 3Frequencies and Specific Risk of the Combination of Genotypes of Y402H and A69S Single-Nucleotide Polymorphisms in Patients with Wet AMD and ControlsAMDNo AMDOR (95% CI)TTCTCCTTCTCCTTTCCCGG1114872779—1.2 (0.5–2.8)5.8 (1.8–18.2)GT162714413182.5 (1.1–6.0)5.7 (2.5–12.9)11.4 (3.9–33.6)TT913846214.7 (3.8–56.1)14.2 (4.5–45.0)26.2 (4.9–139.7)CI = confidence interval; OR = odds ratio.Odds ratios were assessed by logistic regression analysis modeling both single-nucleotide polymorphisms together in wet AMD versus controls for each combined genotype compared with baseline nonrisk genotype (GGTT). Open table in a new tab In this study, there was a higher percentage of smokers among patients with wet AMD than among controls. However, when we analyzed the frequencies of both SNPs for wet AMD and controls in the subsets of smokers and nonsmokers, we found that the obtained frequencies were similar to the total frequencies (Table 1, Table 2). These results showed that the disease state is influenced more by the genetic risk than smoking, which is important but less relevant in our sample population.These data agreed with studies that reported an important role of inflammation and innate immunity in drusen biogenesis and posterior development of choroidal neovascularization. However, the specific association of the LOC387715 gene with wet AMD indicates that, in addition to the CFH alteration, the LOC387715 gene or a variant in strong linkage disequilibrium could also be involved in the development of the neovascular process in AMD. Furthermore, the contribution of LOC387715 to AMD is modified strongly by smoking.5Schmidt S. Hauser M.A. Scott W.K. et al.Cigarette smoking strongly modifies the association of LOC387715 and age-related macular degeneration.Am J Hum Genet. 2006; 78: 852-864Abstract Full Text Full Text PDF PubMed Scopus (290) Google Scholar Thus, the LOC387715 gene could be involved in the progression to advanced AMD by interaction between genes and the environment.In summary, our results showed that in Spanish patients with AMD the associations of both polymorphisms are not equal: Y402H is associated with early and wet AMD, whereas A69S is associated only with wet AMD. The reason for this difference is unclear. However, we hypothesize that the CFH risk allele takes part in drusen formation and consequently initiates the disease. However, in addition to CFH, other genes such as LOC387715, environmental factors (e.g., cigarette smoking), or both could be involved in the development of choroidal neovascularization related to AMD. An understanding of the pathogenesis of age-related macular degeneration (AMD), the most common cause of visual disability in elderly individuals in developed countries, is advancing rapidly, but the pathogenesis remains unclear. Age-related macular degeneration is considered primarily a multifactorial disease that is influenced by age, ethnicity, and a combination of environmental and genetic risk factors.1Haddad S. Chen C.A. Santangelo S.L. Seddon J.M. The genetics of age-related macular degeneration: a review of progress to date.Surv Ophthalmol. 2006; 51: 316-363Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar Until now, genetic studies have reported only variants of several genes that minimally affect the disease, but the last genomewide linkage studies have identified 2 single-nucleotide polymorphisms (SNPs) in 2 regions (1q32 and 10q26) that are strongly associated with AMD. The variant Tyr402His of the complement factor H (CFH) gene, a cofactor in the inactivation of the alternative complement pathway, is the first major AMD susceptibility allele2Klein R.J. Zeiss C. Chew E.Y. et al.Complement factor H polymorphism in age-related macular degeneration.Science. 2005; 308: 385-389Crossref PubMed Scopus (3476) Google Scholar that increases the risk for AMD (odds ratio [OR], 2.1–7.4). In addition, the variant Arg69Ser of LOC387715, a hypothetical protein of unknown function, is the second major AMD susceptibility allele3Kanda A. Chen W. Othman M. et al.A variant of mitochondrial protein LOC387715/ARMS2, not HTRA1, is strongly associated with age-related macular degeneration.Proc Natl Acad Sci U S A. 2007; 104: 16227-16232Crossref PubMed Scopus (360) Google Scholar (OR, 3.45–8.21). Some studies have suggested that the different forms of AMD can arise from diverse physiologic processes.4Yoshida T. Ohno-Matsui K. Ichinose S. et al.The potential role of amyloid beta in the pathogenesis of age-related macular degeneration.J Clin Invest. 2005; 115: 2793-2800Crossref PubMed Scopus (182) Google Scholar Therefore, it is important to confirm the association of both risk alleles with the different forms of AMD. We performed genotyping of Y402H and A69S in a Spanish population (120 patients with advanced wet AMD, 51 patients with early AMD [bilateral soft drusen], and 151 age-matched controls). A significant association was found between wet AMD and both risk alleles, C for Y402H and T for A69S, with ORs of 2.2 (95% confidence interval [CI], 1.5–3.2; P = 9.0×10−6) and 3.4 (95% CI, 2.3–5.0; P = 6.6×10−11), respectively. Patients with early AMD had significant differences only in the C allele (OR, 1.6; 95% CI, 1.0–2.6; P = 0.033). The distribution of genotypes showed a significantly increased risk of neovascular AMD compared with controls in homozygosity of risk alleles, with a 7.7-fold increase (95% CI, 3.0–19.7; P = 2.3×10−5) for Y402H (CC) and an 11.8-fold increase (95% CI, 4.4–31.3; P = 7.5×10−7) for A69S (TT). Meanwhile, the early AMD group had an OR of 3.9 (95% CI, 1.3–11.6) for the CC genotype (Table 1, Table 2 [all tables available at http://aaojournal.org]). The joint contribution of these 2 AMD susceptibility loci was assessed by logistic regression analysis modeling both SNPs together in wet AMD patients versus controls. Our data showed an independent association between both SNPs and wet AMD and an OR of 26.2 (95% CI, 4.9–139.7) for individuals homozygous for risk alleles at both loci (CCTT) compared with the baseline no-risk genotype (TTGG) (Table 3). C = risk allele; CC = risk genotype; CI = confidence interval; NS = not significant; OR = odds ratio. Odds ratios were calculed for C and CC. CI = confidence interval; NS = not significant; OR = odds ratio; T = risk allele; TT = risk genotype. Odds ratio were calculed for T and TT. CI = confidence interval; OR = odds ratio. Odds ratios were assessed by logistic regression analysis modeling both single-nucleotide polymorphisms together in wet AMD versus controls for each combined genotype compared with baseline nonrisk genotype (GGTT). In this study, there was a higher percentage of smokers among patients with wet AMD than among controls. However, when we analyzed the frequencies of both SNPs for wet AMD and controls in the subsets of smokers and nonsmokers, we found that the obtained frequencies were similar to the total frequencies (Table 1, Table 2). These results showed that the disease state is influenced more by the genetic risk than smoking, which is important but less relevant in our sample population. These data agreed with studies that reported an important role of inflammation and innate immunity in drusen biogenesis and posterior development of choroidal neovascularization. However, the specific association of the LOC387715 gene with wet AMD indicates that, in addition to the CFH alteration, the LOC387715 gene or a variant in strong linkage disequilibrium could also be involved in the development of the neovascular process in AMD. Furthermore, the contribution of LOC387715 to AMD is modified strongly by smoking.5Schmidt S. Hauser M.A. Scott W.K. et al.Cigarette smoking strongly modifies the association of LOC387715 and age-related macular degeneration.Am J Hum Genet. 2006; 78: 852-864Abstract Full Text Full Text PDF PubMed Scopus (290) Google Scholar Thus, the LOC387715 gene could be involved in the progression to advanced AMD by interaction between genes and the environment. In summary, our results showed that in Spanish patients with AMD the associations of both polymorphisms are not equal: Y402H is associated with early and wet AMD, whereas A69S is associated only with wet AMD. The reason for this difference is unclear. However, we hypothesize that the CFH risk allele takes part in drusen formation and consequently initiates the disease. However, in addition to CFH, other genes such as LOC387715, environmental factors (e.g., cigarette smoking), or both could be involved in the development of choroidal neovascularization related to AMD.