Activity-dependent Regulation of h Channel Distribution in Hippocampal CA1 Pyramidal Neurons

Minyoung Shin,Dane M Chetkovich

doi:10.1074/jbc.m703736200

Abstract

The hyperpolarization-activated cation current, I(h), plays an important role in regulating intrinsic neuronal excitability in the brain. In hippocampal pyramidal neurons, I(h) is mediated by h channels comprised primarily of the hyperpolarization-activated cyclic nucleotide-gated (HCN) channel subunits, HCN1 and HCN2. Pyramidal neuron h channels within hippocampal area CA1 are remarkably enriched in distal apical dendrites, and this unique distribution pattern is critical for regulating dendritic excitability. We utilized biochemical and immunohistochemical approaches in organotypic slice cultures to explore factors that control h channel localization in dendrites. We found that distal dendritic enrichment of HCN1 is first detectable at postnatal day 13, reaching maximal enrichment by the 3rd postnatal week. Interestingly we found that an intact entorhinal cortex, which projects to distal dendrites of CA1 but not area CA3, is critical for the establishment and maintenance of distal dendritic enrichment of HCN1. Moreover blockade of excitatory neurotransmission using tetrodotoxin, 6-cyano-7-nitroquinoxaline-2,3-dione, or 2-aminophosphonovalerate redistributed HCN1 evenly throughout the dendrite without significant changes in protein expression levels. Inhibition of calcium/calmodulin-dependent protein kinase II activity, but not p38 MAPK, also redistributed HCN1 in CA1 pyramidal neurons. We conclude that activation of ionotropic glutamate receptors by excitatory temporoammonic pathway projections from the entorhinal cortex establishes and maintains the distribution pattern of HCN1 in CA1 pyramidal neuron dendrites by activating calcium/calmodulin-dependent protein kinase II-mediated downstream signals.

Highlights

Certain neurological diseases [1]
Immunohistochemical, and biochemical approaches, here we show that the distal dendritic localization of HCN1 in CA1 pyramidal neurons is regulated by excitatory inputs from the TA pathway and requires activation of ionotropic glutamate receptors and CaMKII
Western blotting of membrane extracts from transfected COS-7 cells showed that ␣-HCN1-(778 –910) recognizes HCN1 but not another h channel subunit enriched in brain tissue, HCN2 (Fig. 1A)

Summary

EXPERIMENTAL PROCEDURES

Antibody Generation—Antibody specific to the C terminus of HCN1 (guinea pig (gp) ␣-HCN1) was prepared commercially (Affinity Bioreagents, Golden, CO) by immunizing guinea pigs with a fusion protein consisting of amino acids 778 –910 of mouse HCN1. cDNA was generated by PCR using primers 5ЈCGCGAATTCATGGAAAGGCGGCGGC and 3Ј-CGCGTCGACTCAGTCACTGTACGGATGG followed by subcloning the PCR product into the EcoRI and BamHI sites of the glutathione S-transferase-producing vector, pGEX-4T1 (GE Healthcare). Primary antibodies including gp ␣-HCN1 (1:1000) and mouse ␣-tubulin (clone DM1A, 1:2000; Sigma) were diluted in block solution containing 5% milk and 0.1% Tween 20 in Tris-buffered saline (TBST) and incubated with membranes overnight at 4 °C or 1 h at RT. Blots were washed 3 ϫ 10 min with TBST, and species-appropriate secondary antibody conjugated to horseradish peroxidase (Amersham Biosciences) was added in TBST containing 5% milk at a dilution of 1:2500. A, protein extracts from COS-7 cells transfected with HCN1-expressing plasmid and mouse brains were separated by SDS-PAGE and blotted with gp ␣-HCN1 antibody. Statistical analysis involved analysis of variance with posthoc analysis using Tukey’s honest significant difference

RESULTS

TA Pathway Projections from

DISCUSSION