Abstract
Abstract Placenta-specific protein 1 (PLAC1) is a small (212aa) secreted protein normally only expressed on the apical surfaces of syncytiotrophoblasts. However, over the past two decades we and other investigators have shown that human cancers and, in particular, cancers of the human reproductive tract, induce PLAC1 expression. In gynecologic cancers, PLAC1 expression has been shown to be associated with risk, histology and TP53 mutation status. A previously unassessed informative SNP rs1982 (A>C) lies in the 3’ untranslated region of the PLAC1 gene. We have begun to explore the utility of this SNP by genotyping a panel of 75 endometrial cancers. The panel is composed of 29 endometrial adenocarcinomas, 10 papillary serous adenocarcinomas, 9 mixed Mullerian tumors, 6 mixed histologies, 2 tumors identified as displaying complex atypia and 1 neuroendocrine tumor. High molecular weight genomic DNA was extracted from these tumors and SNP genotypes determined by directly sequencing a 312bp PCR amplicon generated by the primers: rs1982for: GAGGATTGGTCTCTTCACACAG; rs1982rev: ACAATGTCTGGCCCATACTAAA SNP genotypes were then evaluated against a variety of clinical variables including age, BMI, tobacco use, Charlson Index, co-morbidities, stage, grade, myometrial invasion, recurrence, and death by cancer using both univariate and multivariate logistic regression. Progression-free and overall survival were assessed by Cox Proportional Hazard ratio. Results show that CC homozygotes have increased progression-free and overall survival though neither reached statistical significance. However, several clinical variables were statistically associated with different rs1982 genotypes. Charlson co-morbidity Index was positively associated with presence of the wild-type A allele (OR = 1.61; 1.06 - 2.69; p<0.05), while death from disease was negatively associated (OR = 0.15; 0.03 – 0.64; p<0.02). These differences hold when accounting for other co-variates in the multivariate analysis. These data support further exploration of this SNP in gynecologic cancers. Citation Format: Eric J. Devor, Jesus Gonzalez-Bosquet, Kimberly K. Leslie. SNP rs1982 in the 3’UTR of placenta-specific protein 1 (PLAC1) is associated with endometrial cancer survival [abstract]. In: Proceedings of the AACR Virtual Special Conference: Endometrial Cancer: New Biology Driving Research and Treatment; 2020 Nov 9-10. Philadelphia (PA): AACR; Clin Cancer Res 2021;27(3_Suppl):Abstract nr PO013.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.