Abstract
Mango (Mangifera indica L.) a fruit of nutraceutical value is accepted as the most eatable fruit crop worldwide. Mango production has been severely affected by several biotic stress mainly diseases and anthracnose is the major post-harvest disease of mango results in heavy losses. The present investigation describes PCR based assay for rapid and sensitive detection of Colletotrichum gloeosporioides causing mango anthracnose. Genus specific universal primer pair ITS1 and ITS4 was employed to amplify Colletotrichum genus which shows 560 U bp amplicon. The Colletotrichum gloeosporioides species-specific sequences for conserved domains were retrieved from the NCBI Genbank (sequence HM10205) and specific primers were designed. In order to validate the speciesspecific designed primer, a sensitive nested PCR assay was carried out using designed primer-pair MKCgF 5` TTGCTTCGGCGGGTAGGGTC 3` (forward) and MKCgR 3`ACGCAAAGGAGGCTCCGGGA 5` (reverse) produced an amplicon size of 380 bp as specific. Our investigation revealed that C. gloeosporioides causal agent of mango anthracnose was discriminated on the basis of species as specific for mango in comparison to other Colletotrichum spp. viz. C. acutatum, C. falcatum and C. capsici causing anthracnose in other crops.
Highlights
Mango (Mangifera indica L.) is considered as one of the most popular fruits grown throughout the tropics and subtropics worldwide [1]
C. gloeosporioides an incitant of mango anthracnose is the most important biological constraint which restricts mango production in Southeast Asia [4]
C. gloeosporioides affects mango production both in the pre and post harvest stages when attempting to extend storage life resulting in huge economic losses about 5-20% in the form of damage on the stems, leaves, fruit decay and damage [1,5]
Summary
Mango (Mangifera indica L.) is considered as one of the most popular fruits grown throughout the tropics and subtropics worldwide [1]. The ability to design PCR primers to target specific regions of DNA has led to rapid, accurate, and sensitive detection which is a greater understanding for managing Colletotrichum diseases. The development of species-specific primers has provided a powerful tool for the detection of plant pathogens.
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
