Abstract
BackgroundThe Aim of this study is to study the minimum zinc dependent metalloprotease catalytic folding motif, helix B Met loop-helix C, with proteolytic catalytic activities in metzincin super family. The metzincin super family share a catalytic domain consisting of a twisted five-stranded β sheet and three long α helices (A, B and C). The catalytic zinc is at the bottom of the cleft and is ligated by three His residues in the consensus sequence motif, HEXXHXXGXXH, which is located in helix B and part of the adjacent Met turn region. An interesting question is - what is the minimum portion of the enzyme that still possesses catalytic and inhibitor recognition?”MethodsWe have expressed a 60-residue truncated form of matrilysin which retains only the helix B-Met turn-helix C region and deletes helix A and the five-stranded β sheet which form the upper portion of the active cleft. This is only 1/4 of the full catalytic domain. The E. coli derived 6 kDa MMP-7 ZBD fragments were purified and refolded. The proteolytic activities were analyzed by Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 peptide assay and CM-transferrin zymography analysis. SC44463, BB94 and Phosphoramidon were computationally docked into the 3day structure of the human MMP7 ZBD and TAD and thermolysin using the docking program GOLD.ResultsThis minimal 6 kDa matrilysin has been refolded and shown to have proteolytic activity in the Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 peptide assay. Triton X-100 and heparin are important factors in the refolding environment for this mini-enzyme matrilysin. This minienzyme has the proteolytic activity towards peptide substrate, but the hexamer and octamer of the mini MMP-7 complex demonstrates the CM-transferrin proteolytic activities in zymographic analysis. Peptide digestion is inhibited by SC44463, specific MMP7 inhibitors, but not phosphorimadon. Interestingly, the mini MMP-7 can be processed by autolysis and producing ~ 6 ~ 7 kDa fragments. Thus, many of the functions of the enzyme are retained indicating that the helix B-Met loop-helix C is the minimal functional “domain” found to date for the matrixin family.ConclusionsThe helix B-Met loop-helix C folding conserved in metalloprotease metzincin super family is able to facilitate proteolytic catalysis for specific substrate and inhibitor recognition. The autolysis processing and producing 6 kDa mini MMP-7 is the smallest metalloprotease in living world.
Highlights
The Aim of this study is to study the minimum zinc dependent metalloprotease catalytic folding motif, helix B Met loop-helix C, with proteolytic catalytic activities in metzincin super family
Expression and purification of recombinant rat matrilysin zinc-binding domain (ZBD) domain proteins in Escherichia coli BL 21(DE3) cells The rat cDNA containing zinc-binding domain (a.a. 212– 267) insert corresponding to human cDNA containing zinc-binding domain (a.a. 188–247) of rat matrilysin was synthesized by using a pair of primers, Zn-UMP 5’TCACATATGGGAGTGAACTTCCTGTTT3’ and the Sp6 primer which is from the SP6 promoter region of pGEM3Zf(+) in one-step PCR and sub cloned into the Nde1 and BamH1 sites of PET3a vector (Novae)
It is clear to show that the locations of the catalytic domain consisting of a twisted red β sheet as TAD and long yellow α helices which zincbinding motif located on (Figure 1)
Summary
The Aim of this study is to study the minimum zinc dependent metalloprotease catalytic folding motif, helix B Met loop-helix C, with proteolytic catalytic activities in metzincin super family. The catalytic zinc is at the bottom of the cleft and is ligated by three His residues in the consensus sequence motif, HEXXHXXGXXH, which is located in helix B and part of the adjacent Met turn region. Three histidine residues serve as zinc ligands, and the glutamic acid residue polarizes a water molecule involved in the nucleophilic attack on the scissile peptide bond The mutation of this glutamic acid residue in MMP-7 can lead to reduction of specific activity up to 1000-fold [2]. Another interesting feature is the integrity of the 12 Å wide catalytic groove produced by the combination of the five –stranded α sheet, the catalytic β helix II, and the Met-turn loop (Figure 1). The fourth-strand of this β sheet contributes the major contact area for docking the natural MMP inhibitors, the TIMPs [6,7]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
