Abstract

To better understand the mechanisms that determine cell type-specific gene expression, we have examined the transcriptional activity of a 13-nucleotide long sequence element, designated C3P, located in the promoter of the apoCIII gene. We demonstrate that this element is required for high levels of apoCIII gene expression in hepatic cells and is sufficient to determine hepatic specific expression when introduced into a heterologous promoter. A protein was identified in hepatic cell nuclear extracts, designated AF-1, that binds to this sequence and is presumably responsible for its transcriptional activity in hepatic cells. Even though the C3P element is not active in HeLa cells, a protein with C3P binding specificity was identified in HeLa cell nuclear extracts. While the HeLa protein is similar to the hepatic AF-1 in its binding specificity and relative abundance, it has approximately twice the molecular weight of the hepatic protein, indicating that they are different proteins or different forms of the same protein. A variety of murine tissue types, including those that do not express the apoCIII gene, were found to contain C3P binding proteins. We conclude that the cell type-specific activity of the C3P element is not due to the absence of C3P binding proteins in nonexpressing cells but is the result of qualitative differences in C3P binding proteins in different cell types.

Highlights

  • To better understand the mechanisms that determine in Refs. 1-3)

  • The apolipoprotein CIII (apoCIII) gene is expressed primarily cell type-specific gene expression, we have examined in the liver and to a small extent in the intestine

  • We demonstrate that this of the gene are expressed in HepG2 cells but not in element is required for highlevels of apoCIII gene expression in hepatic cells and is sufficient to determine hepatic specific expression whenintroduced into a heterologous promoter

Read more

Summary

EXPERIMENTAL PROCEDURES

$ Investigator of the American Heart Association, New York City affiliate. § Support,ed by aparticipatinglaboratory fellowship from the American Heart Association, New York City affiliate. The construction -821WT containsthe apoCIIIpromotersequences from -821 to +22 inserted into the CAT expression vector pKT (see Ref. 4 for construction).Themutant apoCIII template -821Xh was constructed by the insertion of a XhoI linker into a repaired BstEII site a t -84 in the wild-type apoCIII promoter. This resulted in the loss of 5 base pairs from -82 to -78 andtheir replacement by the 8-base pairXhoI linker.

HepGE HeLo "
The inactivity of the apoCIII promoter in HeLcaells makes
GCGCTGGGCAAAGGTCACCTGCTCGA CGCGACCCGTTTCCAGTGGACGAGCT
Gene Expression
Distal small intestine Rat liver Human liver
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call