Abstract

This study was conducted to examine the effects of a plant extract mixture, a microencapsulated product composed of eugenol and garlic tincture (PE), on intestinal health in broilers under necrotic enteritis (NE) challenge. A total of 960 d-old mixed-sex Cobb 500 chicks were randomly distributed to 48-floor pens housing 20 birds per pen. Six treatments were applied: UC, unchallenged control; CC, challenged control; PE, challenged group plus PE; AM, challenged group plus antimicrobial (AM); FAP, challenged group plus a full dose of AM with PE; HAP, challenged group plus a half dose of AM with PE in starter, grower and finisher phases. Birds in the challenged groups were inoculated with Eimeria spp. on d 9 and Clostridium perfringens on d 14. On d 16, the CC group had increased serum fluorescein isothiocyanate dextran (FITC-d), reduced villus surface area, goblet cell number, upregulated CLDN1, JAM2 genes and reduced microbial diversity compared to the UC group (p < 0.05). Birds fed PE had reduced FITC-d, increased goblet cell number and Bifidobacterium compared to the CC group (p < 0.05). Birds fed PE had reduced CLDN5 expression in male birds, and Bacteroides spp. in female birds than CC group (p < 0.05). These findings suggest that PE supplementation mitigates the effect of NE by improving the intestinal health of birds.

Highlights

  • Necrotic enteritis (NE) is a devastating enteric bacterial disease in the highly productive poultry industry with an estimated profitability loss of over US$6 billion per annum [1].It is primarily caused by Clostridium perfringens, a Gram-positive, ubiquitous, anaerobic, spore-forming bacterium that is present in the normal intestinal flora of healthy chickens [2].The bacterium C. perfringens in the intestinal tract under the favourable conditions together with one or more predisposing factors can become pathogenic due to the overgrowth ofNetB toxin-producing strains leading to the occurrence of necrotic enteritis (NE)

  • It was hypothesised that the supplementation of plant extract, a microencapsulated product composed of eugenol and garlic tincture (PE), may help mitigate the negative effects of clinical NE on intestinal health

  • The NE challenge model was applied in the present study following previously reported challenge protocols [4,35] where field strains of Eimeria spp. oocysts were employed as a predisposing factor and C. perfringens as the causative agent to introduce NE

Read more

Summary

A Microencapsulated Mixture of Eugenol and Garlic Tincture

Kheravii 1 , Catherine Ionescu 2 , Alexandra Blanchard 2 , Reza Barekatain 3 , Yadav S. Integrity and Increases Goblet Cells in Broilers.

Introduction
Ethics Statement
Design and Husbandry
Dietary Treatments
Necrotic Enteritis Challenge
Sampling and FITC-d Inoculation
Serum FITC-d Measurement
Histomorphology
RNA Extraction and cDNA Synthesis
F: GAAGCTTACTGGAATGGCTTTCC
2.10. Extraction of Ileal Bacterial DNA
2.12. Quantification of Ileal and Caecal Bacterial DNA
2.14. Data Analysis
Serum FITC-d Concentration
Histomorphology and Goblet Cell Number
Jejunal Gene Expression on d 8
Jejunal Gene Expression on d 16
Ileal Bacterial Load by qPCR
10. Two-way
Caecal Microbiota Diversity
Microbial showing
Discussion extracts to some extent has shown to be effective against
Conclusions
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call