Abstract
BackgroundThe efficient and rapid extraction of high‐quality genomic DNA from clotted blood samples, which normally have a low yield and poor quality, is an important factor in genomic research. The objective of this study was to develop a simple and safe technique for dispersing the blood clots by the ball bearing metal shots. Normally, such clot samples may not have an acceptable yield by conventional DNA extraction methods. Also, in the present study, we have further investigated to improve salting‐out DNA extraction methods.MethodsInitially, 500 µL phosphate‐buffered saline (PBS) (1×) and two ball bearing metal shots were added to each tube of the clotted blood sample and then were gently rotated in an electric laboratory rotator for 1 hour at room temperature (18‐25°C). Genomic DNA was then extracted from samples using a modified salting‐out method and a modified QIAamp® DNA Blood Midi Kit and was compared with QIAamp® DNA Blood Midi Kit as a control. An assessment of the concentration and quality of the extracted DNA was performed using the UV‐visible spectrophotometer. The isolated DNA proved amenable to PCR amplification and gel electrophoresis.ResultsThe yield and purity of DNA obtained by these three methods were significantly different (P < 0.001), with a higher yield in the modified salting‐out method.ConclusionsOur proposed modified salting‐out method is simple and efficient for the isolation of DNA from old blood clot samples. It is both easy to use and is of low cost in routine laboratory tasks.
Highlights
In recent years, molecular techniques have become important tools in identifying populations, finding mutations, and determining the genetic diversity, quantity, and identification of pathogens{Shams, 2011 #2384;Nasiri, 2005 #2385;Nasiri, 2005 #2385}.1,2 One of the routine tasks in molecular biology is DNA extraction
A polymerase chain reactions (PCRs) reaction was performed to check the quality of purified DNA and to determine whether any inhibitory material was interfering with the reaction
Exon 3 of the crystalline gamma‐ D (CRYGD) gene with a fragment of 636 base pairs was amplified in a 10 μL reaction, 3 μL Taq DNA Polymerase 2× Master Mix Red (Ampliqon), one microliter of extracting DNA, and 0.5 pmol forward primer (5′‐TGAATCTCTGTGGGTAATG‐3′) and 0.5 pmol reverse primer (5′ CGTCATTCTGTTGTGAGAACTTCC 3′)
Summary
Molecular techniques have become important tools in identifying populations, finding mutations, and determining the genetic diversity, quantity, and identification of pathogens{Shams, 2011 #2384;Nasiri, 2005 #2385;Nasiri, 2005 #2385}.1,2 One of the routine tasks in molecular biology is DNA extraction. Some methods have optimized DNA extraction from clotted blood, which are normally discarded.[8]. The efficient and rapid extraction of high‐quality genomic DNA from clotted blood samples, which normally have a low yield and poor quality, is an impor‐ tant factor in genomic research. The objective of this study was to develop a simple and safe technique for dispersing the blood clots by the ball bearing metal shots. Such clot samples may not have an acceptable yield by conventional DNA extraction methods. Methods: Initially, 500 μL phosphate‐buffered saline (PBS) (1×) and two ball bearing metal shots were added to each tube of the clotted blood sample and were gen‐ tly rotated in an electric laboratory rotator for 1 hour at room temperature (18‐25°C). Previous presentation: These data have not been presented as an abstract or in the meetings
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
