Abstract
Monoamine oxidase (MAO) oxidizes biologically important amines including neurotransmitters and plays a central role in the regulation of intracellular level of these amines. Two distinct forms of MAO (MAO A and MAO B) were defined based on differences in substrate and inhibitor specificities. We earlier reported that the region between about residues 120 and 220 of rat MAO is responsible for determination of the substrate selectivity of MAO A and B (Tsugeno, Y. Hirashiki, I., Ogata, F., and Ito, A. (1995) J. Biochem. (Tokyo) 118, 974-980). To determine the essential amino acids in this region that participate in substrate recognition, a series of mutant enzymes in which amino acid residues that are conserved among various species but are different between the two forms of the enzyme were replaced with the corresponding amino acids of the counterpart and were engineered from the cDNAs of rat liver MAO A and B, and affinities for several substrates were examined. A single mutation in which Phe-208 in MAO A was substituted by the corresponding residue of Ile in MAO B was sufficient to convert the A-type substrate selectivity, and the reverse was exactly the case. Phe at this position was replaceable with Tyr for the A-type specificity and Ile was replaceable with Val and Ala for the B-type. Thus, aromatic and aliphatic residues seem to contribute to render substrate selectivity of MAO A and MAO B, respectively.
Highlights
The extent of Monoamine oxidase (MAO) activity is associated with various behavioral aberrations
An enzyme with aromatic amino acids, such as Phe and Tyr, at this position has a similar affinity for all substrates examined, whereas ones with amino acids with an aliphatic side chain, such as Ile, Val, and Ala, have little affinity for serotonin and tyramine and a high affinity for tryptamine and PEA, these amino acids are usually classified as hydrophobic amino acids
A good correlation between aromatic amino acid at this position and MAO A-type substrate specificity was seen in trout MAO [29], which has Phe at this position and properties in substrate specificity and inhibitor sensitivity more like those of mammalian MAO A, it does share a similar extent of homology with both mammalian MAO A and MAO B
Summary
Materials—Oligonucleotides were purchased from Biologica Co. (Nagoya, Japan). Restriction endonucleases and DNA-modifying enzymes were purchased from Nippon Gene (Toyama, Japan), Toyobo (Osaka, Japan), Takara Shuzo (Kyoto, Japan), and New England Biolabs Inc. (Beverly, MA). Restriction endonucleases and DNA-modifying enzymes were purchased from Nippon Gene (Toyama, Japan), Toyobo (Osaka, Japan), Takara Shuzo (Kyoto, Japan), and New England Biolabs Inc. Zymolyase 100T was from Seikagaku Kogyo (Tokyo, Japan). The radiochemicals, 5-[2-14C]hydroxytryptamine bioxalate (serotonin) (41.1 mCi/ mmol), [side chain-2-14C]tryptamine bisuccinate (40 mCi/mmol), [1-14C]tyramine hydrochloride (45.2 mCi/mmol), and -[1-14C]phenylethylamine hydrochloride (56 mCi/mmol) were from New England Nuclear (Boston, MA). Site-directed Mutation of MAOs—The cDNAs for rat MAO A [21] and MAO B [20] were subcloned into the M13mp vector. Site-directed mutagenesis was performed with synthetic oligonucleotides, according to the procedure used by Kunkel et al [25]. Oligonucleotides GCCGCCATTGGTAACGCTAGCTATCCGAGCAGTGCC, TGGTAACTGAGATTATCCGAGCAGT, GTAACTGAGACTATCCGAGCA, GGTAACTGAGTATATCCGAGC, CTCTTCAGCATGCGGTGCCTTCC, ACCTCATGGGGCTCACTAGTTACATTTAGGTTCACA, and GTTGTTGAGAAGATTCTGG were used to obtain MAO A(F208A), MAO A(F208I), MAO A(F208V), MAO A(F208Y), MAO B(L239H), MAO B(C172N/A175S/ T177P), and MAO B(I199F), respectively. The original and chimeric cDNAs constructed above were inserted into pYcDE2, a yeast expression vector
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
