A high-throughput pipeline for the design of real-time PCR signatures

Ravi Vijaya Satya,Jaques Reifman,Nela Zavaljevski,Kamal Kumar

doi:10.1186/1471-2105-11-340

Abstract

BackgroundPathogen diagnostic assays based on polymerase chain reaction (PCR) technology provide high sensitivity and specificity. However, the design of these diagnostic assays is computationally intensive, requiring high-throughput methods to identify unique PCR signatures in the presence of an ever increasing availability of sequenced genomes.ResultsWe present the Tool for PCR Signature Identification (TOPSI), a high-performance computing pipeline for the design of PCR-based pathogen diagnostic assays. The TOPSI pipeline efficiently designs PCR signatures common to multiple bacterial genomes by obtaining the shared regions through pairwise alignments between the input genomes. TOPSI successfully designed PCR signatures common to 18 Staphylococcus aureus genomes in less than 14 hours using 98 cores on a high-performance computing system.ConclusionsTOPSI is a computationally efficient, fully integrated tool for high-throughput design of PCR signatures common to multiple bacterial genomes. TOPSI is freely available for download at http://www.bhsai.org/downloads/topsi.tar.gz.

Highlights

Pathogen diagnostic assays based on polymerase chain reaction (PCR) technology provide high sensitivity and specificity
In the regions where Tool for PCR Signature Identification (TOPSI) does not report any signature, KPATH does not report any signature, indicating that these regions are not suitable for designing unique PCR signatures. These results provide semi-quantitative validation that the number of signatures reported by TOPSI is similar to that reported by KPATH, and that the TOPSI signatures are distributed throughout the genome without the conspicuous omission of any region for which PCR signatures have been reported by KPATH
The TOPSI pipeline is efficient in designing real-time PCR signatures that are common to multiple strains of a bacterial pathogen, and are unique to the pathogen with respect to all other sequenced non-target genomes

Summary

Results

We report signatures designed by TOPSI and compare them with those designed by other software systems as well as some experimentally verified signatures. With these inputs, TOPSI designed 11 real-time PCR signatures in which all three components were unique to and present in all the 11 B. mallei genomes. In the current TOPSI framework, PCR signatures are designed from genomic regions that are conserved among all the input genomes This might potentially lead to a situation in which signatures common to a large number of input genomes are eliminated because of a single low-quality or incomplete genome sequence. One possible solution for this problem is to apply a lower threshold for consensus, so that signatures can be designed from regions that are conserved among a large percentage of the input genomes This approach is compatible with the current TOPSI framework and could be incorporated into the system. Another solution using the current TOPSI framework is to design signatures based solely on

Background

GGTCTACAGCTCCGCGAATT

Conclusions