A Furin-like Convertase Mediates Propeptide Cleavage of BACE, the Alzheimer's β-Secretase

Brian D Bennett,Paul Denis,Mitsuru Haniu,David B Teplow,Steve Kahn,Jean-Claude Louis,Martin Citron,Robert Vassar

doi:10.1074/jbc.m005339200

Brian D Bennett, Paul Denis + Show 6 more

Open Access

https://doi.org/10.1074/jbc.m005339200

Copy DOI

Abstract

The novel transmembrane aspartic protease BACE (for Beta-site APP Cleaving Enzyme) is the beta-secretase that cleaves amyloid precursor protein to initiate beta-amyloid formation. As such, BACE is a prime therapeutic target for the treatment of Alzheimer's disease. BACE, like other aspartic proteases, has a propeptide domain that is removed to form the mature enzyme. BACE propeptide cleavage occurs at the sequence RLPR downward arrowE, a potential furin recognition motif. Here, we explore the role of furin in BACE propeptide domain processing. BACE propeptide cleavage in cells does not appear to be autocatalytic, since an inactive D93A mutant of BACE is still cleaved appropriately. BACE and furin co-localize within the Golgi apparatus, and propeptide cleavage is inhibited by brefeldin A and monensin, drugs that disrupt trafficking through the Golgi. Treatment of cells with the calcium ionophore, leading to inhibition of calcium-dependent proteases including furin, or transfection with the alpha(1)-antitrypsin variant alpha(1)-PDX, a potent furin inhibitor, dramatically reduces cleavage of the BACE propeptide. Moreover, the BACE propeptide is not processed in the furin-deficient LoVo cell line; however, processing is restored upon furin transfection. Finally, in vitro digestion of recombinant soluble BACE with recombinant furin results in complete cleavage only at the established E46 site. Taken together, our results strongly suggest that furin, or a furin-like proprotein convertase, is responsible for cleaving the BACE propeptide domain to form the mature enzyme.

Highlights

At the histopathological level, AD1 is characterized by neurofibrillary tangles and amyloid plaques throughout the parenchyma of the brain, as well as amyloid deposits in the cerebral vasculature
BACE and furin co-localize within the Golgi apparatus, and propeptide cleavage is inhibited by brefeldin A and monensin, drugs that disrupt trafficking through the Golgi
The sequence RLPR2E at the propeptide cleavage site of BACE is a potential furin recognition motif; ; we have investigated whether furin may be the protease that cleaves the BACE propeptide domain

Summary

EXPERIMENTAL PROCEDURES

Cell Culture and Transfections—293T cells were maintained in 10% fetal bovine serum in DMEM, high glucose media (Life Technologies, Inc.). LoVo cells were grown in 10% fetal bovine serum in DMEM/F-12 1:1 media (Life Technologies, Inc.). ␣1-Antitrypsin was cloned by PCR from human liver cDNA using the primers CCATCGATGGACAGTGAATCGACAATG and GAAGATCTGGTTGAGGAGCGAGAGGCAG. Metabolic Labeling and Immunoprecipitations—24 – 48 h post-transfection, 293T or LoVo cells grown in 10-cm dishes (ϳ7 ϫ 106 cells) were incubated in DMEM minus methionine for 1 h at 37 °C. Cells were labeled for 30 min or 1 h with 1 mCi/10 cm dish of [35S]methionine and chased in complete growth media supplemented with 2.5 mM methionine for designated times. For inhibitor experiments ϳ7 ϫ 106 BACEHA/293 cells were labeled for 1 h using the above protocol and subsequently chased for 5 h in complete growth media supplemented with 2.5 mM methionine plus or minus inhibitor.

Furin Cleaves BACE Propeptide

RESULTS

DISCUSSION

Additions and Corrections